Mapping Non-Class II H2-Linked Loci for Type 1 Diabetes in Nonobese Diabetic Mice
Major histocompatibility complex (MHC) plays a largely predominant role in the genetic predisposition to type 1 diabetes, in both humans and rodents. While class II loci have long been recognized as essential, they do not fully explain the MHC-linked genetic component of type 1 diabetes. In the present study, using new NOD congenic strains harboring defined chromosomal segments from C57BL/6 mice, we circumscribed three distinct loci influencing murine type 1 diabetes and tightly linked to but separated from the class II region. Our findings might guide the search for additional HLA-linked loci in human type 1 diabetes. Diabetes 53: 3323-3327, 2004
CYP, cyclophosphamide; MAPK, mitogen-activated protein kinase; MHC, major histocompatibility complex.
2004 by the American Diabetes Association.
There is substantial evidence that class II loci do not fully explain the genetic predisposition to type 1 diabetes as linked to major histocompatibility complex (MHC) (1). In human type 1 diabetes, the identification of the additional loci remains a challenge owing to strong linkage disequilibria across the HLA complex (2,3). Conversely, in the mouse, congenic strains provide a powerful tool to overcome some of the problems arising from allelic associations (4). Using the nonobese diabetic (NOD) mouse strain, evidence for at least one non-class II MHC-linked locus, termed Idd16, was obtained (5,6). The Idd16 locus was further defined with the breeding of a congenic line, R114, harboring a 12-cM interval from C57BL/6 mice, proximal to and separated from the H2 complex (7). NOD.B6-Idd16 mice were markedly protected against diabetes and also against chronic autoimmune thyroiditis after immunization with thyroglobulin in Freund’s complete adjuvant.
In the present study, we have refined the Idd16 interval using a first series of five subcongenic lines derived from R114. Four lines, including R76, R14, R115, and R12, shared the distal end of the R114 interval and retained segments of variable extent from this end (Table 1). As shown in Fig. 1A-C, the three lines with the largest segments, R76, R14, and R115, were protected against spontaneous diabetes, although the nearly complete protection afforded by the original R114 interval (with a 5% final incidence of diabetes) was not maintained. Mice of the R115 strain, corresponding to the smallest protective interval, had an incidence of diabetes of 27.3% compared with 77.8% in NOD mice (P = 2 10^sup -5^). Diabetes incidence in R14 (52.7%) and R76 (51.8%) mice was similarly decreased compared with NOD mice (P = 5 10^sup -4^ and P < 1 10^sup -6^, respectively) and was not significantly different from that in R115 mice. In contrast, R12 mice, which harbored the smallest interval, were not protected at all against diabetes (Fig. 1D). The fifth line, R156, retained the proximal part of the R114 interval and was of the B6 type between the D17Mit113 and D17Mit260 markers (Table 1). The R156 mice had a slightly but significantly decreased final incidence of diabetes (64.15%) compared with NOD mice (P = 0.03) (Fig. 1E).
Taken together, the data indicated that the protection afforded by the original R114 region was caused by at least two loci. The most protective one, which we propose to designate as Idd16, could be mapped between D17Mit100 on the centromeric side, i.e., the proximal boundary of the R115 interval, and D17Mit101 on the telomeric end, i.e., the proximal boundary of the R12 interval. The physical size of the Idd16 interval is currently estimated to be 3.1 Mb, and its distal boundary is situated at 4.75 Mb, centromerically to the H2-K gene, the most proximal locus of the H2 complex. It is located toward the proximal end of the intervals described in previous studies (5,6). The gene mapped by Hattori et al. (6) in the G3-B line could be the same, since the diabetes-resistant strain used in their study, B10.A(R209), had a non-H2 genetic background (C57BL/10) that is closely related to the C57BL/6 used in our study. This is also assuming that the H2^sup r209^) haplotype in this strain did not extend into the Idd16 interval. In contrast, as previously discussed (7), the gene mapped by Igekami et al. (5) could well be different, as the partner strain used in their study (CTS) appears to show specific allelic variations compared with NOD (8).
The second locus, defined by the R156 interval and which we propose to designate as Idd23, provided a weaker protection and mapped to a still large chromosomal segment of ~20 Mb. It could explain the higher incidence of diabetes in the G3-B compared with the G3-A line reported by Hattori et al. (6), since G3-B differed from G3A in that it lost a centromeric segment from the donor strain overlapping with the R156 interval.
The two loci, Idd16 and Idd23, appeared to differ by their mode of action. The protection afforded by the B6 allele of Idd23 was dominant as (NODxR156) F1 mice had an incidence of diabetes similar to that of homozygous R156 mice and different from that of NOD mice (P = 0.01) (Fig. 1E). In contrast, (NODxR14) F1 mice developed diabetes similarly to NOD mice and differently than the R14 homozygous mice (P = 0.003) (Fig. 1B), suggesting a recessive mode of action for Idd16.
TABLE 1
Genetic characterization of congenic strains
Using a second series of subcongenic lines derived from the R1 congenic strain, we have also investigated the region distal to the H2 complex. One line, R289, retained a large interval for which the maximal size is currently estimated at 12.1 Mb (Table 1). The proximal breakpoint was localized in the H2 complex, between the Lta and H2-Q4 genes. Therefore, in this line, the proximal class I and the class II genes were of the NOD type, while the distal end of the H2 region was of the B6 type. The distal boundary of the interval mapped between the D17Mit36 and D17Mit66 markers. The B6 interval harbored by the second line, R300, was included in that of R289 and shared its distal end with it. The proximal breakpoint was not precisely located in a 5.2-Mb segment, between a microsatellite telomeric to the H2-Q gene cluster and the D17Mit105 marker. As shown in Fig. 1F, the R289 line had an incidence of diabetes of 53.6% and was therefore mildly but significantly protected (P = 0.044). In contrast, R300 mice developed diabetes similarly to the control mice. We propose to designate this locus as Idd24. It currently maps between the Lta locus and the D17Mit105 marker. It should be nonetheless confirmed by a second follow up of diabetes and the breeding of subcongenic strains.
Altogether, we were able to identify three distinct intervals with a role in type 1 diabetes, in addition to the class II genes, in a 35-Mb chromosomal segment surrounding the H2 complex. The use of congenic mice harboring defined segments was essential to demonstrate the existence of the different loci, given the strength of the class II loci in type 1 diabetes predisposition. Previous studies have not reported a type 1 diabetes locus more distant from the H2 complex on chromosome 17 (9,10). We also failed to detect such a locus in an (NODxBG)xNOD backcross (unpublished data). Therefore, it is unlikely that an additional major locus on this chromosome influences diabetes predisposition by itself, at least in the strain combination investigated.
As previously reported, the R114 interval profoundly influenced the development of inflammatory infiltrates directed at self- antigens, including in the pancreata and the thyroid glands of NOD mice (7). To investigate the cellular response against an exogenous antigen, mice were immunized with ovalbumin emulsified in complete Freund’s adjuvant and were challenged 7 days later in the footpads with the antigen or with PBS in incomplete Freund’s adjuvant. As shown in Fig. 2, specific swelling was significantly more intense and more prolonged in NOD than in B6 mice (P < 1 10^sup -4^). However, R114 mice responded exactly as NOD mice, strongly suggesting that the immune-regulatory pathways involved in the response to foreign antigens and against self-antigens are not identical and that the R114 interval might specifically alter the control of anti-self-reactivity. Consistent with this hypothesis was the resistance of R114 mice to cyclophosphamide (CYP)-induced diabetes. CYP is a DNA alkylating agent with complex immunoregulatory properties (11-13). Following treatment with a high dose of CYP, the course of diabetes is markedly accelerated in NOD mice (14). As seen in Fig. 3, the final incidence of diabetes in R114 mice treated with this protocol was significantly decreased (P = 0.0028). Taken together, the data indicate that the R114 interval affects an important immunoregulatory pathway controlling the development of type 1 diabetes (15) and potentially the response against other self-antigens as well. The study of R114 mice might also provide useful insight into the immunopharmacologic properties of CYP.
FIG. 1. Course of spontaneous diabetes in resistant and susceptible congenic mice and in control NOD female mice that were followed at the same time. The cumulative proportion of surviving mice (Kaplan-Meier) in each group has been plotted as a function of time. Censored observations are marked with +.
The maximal size of the Idd16 interval, currently 3.1 Mb, was estimated using the ext\reme position of the recombination breakpoints, i.e., D17Mit100 and D17Mit101. It will be essential to refine their actual location by typing the neighbor polymorphisms to reduce the interval that currently contains 37 annotated genes (Ensembl database, build 32). Among the candidates, the tightly linked MAPK13 and MAPK14 genes encode the p38δ and p38α mitogen-activated protein kinases (MAPKs), respectively. The p38 MAPK pathway exerts a major influence on activation of inflammatory T-cells and notably on production of interferon-γ (16). In addition, treatment of NOD mice with an inhibitor of p38 MAPK prevents the onset of diabetes (17). However, the effects of p38 MAPK are likely to be quite complex, as STAT1, which mediates signaling of interferon-γ, is phosphorylated by p38 MAPK (18). This transcriptional activator plays an important role in the development of regulatory T-cells, and its germline inactivation increases susceptibility to autoimmunity (19).
The human synteny equivalent to Idd16 is tightly linked to the HLA complex and maps just centromerically to the class II region. A previous study reported an association of the D6S291 marker, situated at 270 kb from the human MAPK14 gene, with type 1 diabetes in the Scandinavian population (20) but not in other populations (21,22). However, a low density of markers was used in these investigations, and this large region shows a low level of linkage disequilibrium, contrary to the HLA region itself (21-23). Our findings might therefore justify a reinvestigation of this region in different populations using a denser map of markers.
FIG. 2. Delayed-type hypersensitivity response to ovalbumin is not altered in R114 mice ([diamonds]) compared with NOD mice ([white circle]). The response, however, was significantly different in B6 mice ([black square]). Vertical bars denote 95% CIs around the means.
The finding of several Idd loci linked to the H2 complex is consistent with the high density of genes expressed in the immune system in this region and contributes to the explanation of its unique strength in type 1 diabetes predisposition. Importantly, H2- congenic mice are widely used in functional studies, notably aiming at understanding the pathogenesis of type 1 diabetes. Our study emphasizes the importance of accurately defining the congenic intervals to improve the correlation between the cellular and molecular changes observed and type 1 diabetes pathogenesis.
RESEARCH DESIGN AND METHODS
Congenic strains and microsatellite markers. Mice were housed in our animal facility under specific pathogen-free conditions and in keeping with the European legislation on animal care and experimentation. NOD and C57BL/6J (B6) were bred through sister- brother mating. R114 and R1 congenic mice carrying different portions of chromosome 17 (Table 1) were previously derived from a stock of NOD.H2-B6 congenic mice obtained after 17 generations of iterative backcrossing (7). New recombinant congenic lines were derived from R114 and R1 by backcrossing (R114xNOD)F1 and (R1xNOD)F1 mice with NOD parents, followed by appropriate genotypic selection and sister-brother mating to achieve homozygosity. Sequences of amplification primers for two new microsatellites situated in the genomic clone MMHC322F16 (Genbank accession number AF111103) are as follows: MS-51, forward CTGTTTGCTTTGTCTCCTGG and reverse AATGTACACGCTTGCAC GAG; MS-154, forward ATTCAGCTGCAAATCCCTGC and reverse GTAGC TGAGCCTTTCATTCC. Other microsatellite markers are referenced in the Mouse Genome Database, release 2.98 (24) (available from www.informatics. jax.org).
FIG. 3. Resistance of R114 congenic mice ([white circle]) to induction of diabetes by cyelophosphamide compared with NOD controls ([black square]). The difference between the two groups was significant (P = 0.0028).
Spontaneous and CYP-induced diabetes. Spontaneous diabetes was monitored weekly by testing glycosuria with Glukotest (Roche Diagnostics, Basel, Switzerland). Mice were classified as diabetic after producing two consecutive tests ≥3. Equivalent numbers of female congenic and NOD control mice were kept in each cage. Incidences of diabetes were compared with the log-rank test. Alternatively, diabetes was induced by a single intraperitoneal injection of CYP (300 mg/kg). Ten days later, glycosuria was monitored daily during 20 days. Incidences were then compared with the nonparametric Cox test, as the groups were small.
Delayed-type hypersensitivity response. The antigen, 100 g of ovalbumin (grade V, Sigma) emulsified in complete Freund’s adjuvant, was injected at the base of the tail. Seven days later, ovalbumin (500 g, grade II) emulsified in incomplete Freund’s adjuvant was injected in the rear footpad. PBS in incomplete Freund’s adjuvant was injected in the contra lateral footpad of the same animal as the control. Swelling was measured at the indicated time points. An ANOVA with repeated measures of the differential swelling of test and control footpads was performed with the Statistica software (Statsoft, Tulsa, OK) to assess the significance of the genetic factor.
ACKNOWLEDGMENTS
This work was supported by funds from the Institut National de la Sant et de la Recherche Mdicale (INSERM).
The authors are most grateful to Fabrice Valette and Mickal Garcia for their invaluable help in mouse breeding, Guy Fluteau for genotyping assistance, and Dr. Matthieu Levi-Strauss for critical reading of the manuscript.
REFERENCES
1. Undlien DE, Lie BA, Thorsby E: HLA complex genes in type 1 diabetes and other autoimmune diseases: which genes are involved? Trends Genet 17: 93-100, 2001
2. Dawkins RL, Christiansen FT, Kay PH, Garlepp M, McCluskey J, Hollingsworth PN, Zilko PJ: Disease associations with complotypes, supratypes and haplotypes. Immunol Rev 70:1-22, 1983
3. She JX, Marron MP: Genetic susceptibility factors in type 1 diabetes: linkage, disequilibrium and functional analyses. Curr Opin Immunol 10:682-689, 1998
4. Rogner UC, Avner P: Congenic mice: cutting tools for complex immune disorders. Nat Rev Immunol 3:243-252, 2003
5. Ikegami H, Makino S, Yamato E, Kawaguchi Y, Ueda H, Sakamoto T, Takekawa K, Ogihara T: Identification of a new susceptibility locus for insulin-dependent diabetes mellitus by ancestral haplotype congenic mapping. J Clin Invest 96:1936-1942, 1995
6. Hattori M, Yamato E, Itoh N, Senpuku H, Fujisawa T, Yoshino M, Fukuda M, Matsumoto E, Toyonaga T, Nakagawa I, Petruzzelli M, McMurray A, Weiner H, Sagai T, Moriwaki K, Shiroishi T, Maron R, Lund T: Cutting edge: homologous recombination of the MHC class I K region defines new MHC-linked diabetogenic susceptibility gene(s) in nonobese diabetic mice. J Immunol 163:1721-1724, 1999
7. Boulard O, Damotte D, Deruytter N, Fluteau G, Carnaud C, Garchon HJ: An interval tightly linked to but distinct from the H2 complex controls both overt diabetes (Idd16) and chronic experimental autoimmune thyroiditis (Ceat1) in nonobese diabetic mice. Diabetes 51:2141-2147, 2002
8. Babaya N, Ikegami H, Fujisawa T, Ueda H, Nojima K, Itoi- Babaya M, Yamada K, Kawaguchi Y, Yamato E, Makino S, Ogihara T: Sequence analysis of Tnf as a candidate for Idd16. Autoimmunity 35:63-66, 2002
9. Wicker LS, Todd JA, Peterson LB: Genetic control of autoimmune diabetes in the NOD mouse. Annu Rev Immunol 13:179-200, 1995
10. Serreze DV, Leiter EH: Genes and cellular requirements for autoimmune diabetes susceptibility in nonobese diabetic mice. Curr Dir Autoimmun 4:31-67, 2001
11. Askenase PW, Hayden BJ, Gershon RK: Augmentation of delayed- type hypersensitivity by doses of cyclophosphamide which do not affect antibody responses. J Exp Med 141:697-702, 1975
12. Brooks-Kaiser JC, Bourque LA, Hoskin DW: Heterogeneity of splenic natural suppressor cells induced in mice by treatment with cyclophosphamide. Immunopharmacology 25:117-129, 1993
13. Angulo I, de las Heras FG, Garcia-Bustos JF, Gargallo D, Munoz-Fernandez MA, Fresno M: Nitric oxide-producing CD11b(+)Ly- 6G(Gr-1)(+)CD31(ER-MP12)(+) cells in the spleen of cyclophosphamide- treated mice: implications for T-cell responses in immunosuppressed mice. Blood 95:212-220, 2000
14. Yasunami R, Bach JF: Anti-suppressor effect of cyclophosphamide on the development of spontaneous diabetes in NOD mice. Eur J Immunol 18: 481-484, 1988
15. Delovitch TL, Singh B: The nonobese diabetic mouse as a model of autoimmune diabetes: immune dysregulation gets the NOD. Immunity 7: 727-738, 1997
16. Rincon M, Pedraza-Alva G: JNK and p38 MAP kinases in CD4+ and CD8+ T cells. Immunol Rev 192:131-142, 2003
17. Ando H, Kurita S, Takamura T: The specific p38 mitogen- activated protein kinase pathway inhibitor FR167653 keeps insulitis benign in nonobese diabetic mice. Life Sci 74:1817-1827, 2004
18. Goh KC, Haque SJ, Williams BR: p38 MAP kinase is required for STAT1 serine phosphorylation and transcriptional activation induced by interferons. EMBO J 18:5601-5608, 1999
19. Nishibori T, Tanabe Y, Su L, David M: Impaired development of CD4+ CD25+ regulatory T cells in the absence of STAT1: increased susceptibility to autoimmune disease. J Exp Med 199:25-34, 2004
20. Lie BA, Todd JA, Pociot F, Nerup J, Akselsen HE, Joner G, Dahl-Jorgensen K, Ronningen KS, Thorsby E, Undlien DE: The predisposition to type 1 diabetes linked to the human leukocyte antigen complex includes at least one non-class II gene. Am J Hum Genet 64:793-800, 1999
21. Herr M, Dudbridge F, Zavattari P, Cucca F, Guja C, March R, Campbell RD, Barnett AH, Bain SC, Todd JA, Koeleman BP: Evaluation of fine mapping strategies for a multifactorial disease locus: systematic linkage and association analysis of IDDM1 in the HLA region on chromosome 6p21. Hum Mol Genet 9:1291-1301, 2000
22. Johansson S, Lie BA, Cambon-Thomsen A, Pociot F, Nerup J, Kockum I, Thorsby E, Undlien DE: No evidence of type 1 diabetes susceptibility genes in the region centromeric of the HLA complex. Hum Immunol 64:951-959,2003
23. Stenzel A, Lu T, Koch WA, Hampe J, Guenther SM, De La Vega FM, Krawczak M, Schreiber S: Patterns of linkage disequilibrium in the MHC region on human chromosome 6p. Hum Genet 114:377-385, 2004
24. Blake JA, Richardson JE, Bull CJ, Kadin JA, Eppig JT: MGD: the Mouse Genome Database. Nucleic Acid Res 31:193-195, 2003
From the INSERM U580 and Universit Paris V-Rene Descartes, Paris, France.
Address correspondence and reprint requests to Henri-Jean Garchon, INSERM U580, 161 rue de Svres, 75743 Paris cedex 15, France. E-mail: garchon@necker.fr.
Received for publication 10 June 2004 and accepted in revised form 25 August 2004.
Copyright American Diabetes Association Dec 2004
