Quantcast
  • E-mail
  • Print
  • Comment
  • Font Size
  • Digg
  • del.icio.us
  • Discuss article

Positional Identification of an Asthma Susceptibility Gene on Human Chromosome 5q33

Posted on: Friday, 29 July 2005, 03:01 CDT

Rationale: Asthma is a common respiratory disease with complex genetic components. We previously reported strong evidence for linkage between mite-sensitive asthma and markers on chromosome 5q33. This area of linkage includes a region homologous to a mouse area that contains a locus involved in regulation of airway hyperreactivity. Objective: The aim of the present study is to identify asthma susceptibility genes on chromosome 5q33. Methods and Results: We performed mutation screening and association analyses of genes in the 9.4-Mb human linkage region. Transmission disequilibrium test analysis of 105 polymorphisms in 155 families with asthma revealed that six polymorphisms in cytoplasmic fragile X mental retardation protein (FMRP)-interacting protein 2 gene were associated significantly with the development of asthma (p = 0.000075; odds ratio, 5.9). These six polymorphisms were in complete linkage disequilibrium. In real-time quantitative polymerase chain reaction analysis, subjects homozygous for the haplotype overtransmitted to asthma-affected offspring showed significantly increased level of cytoplasmic FMRP interacting protein 2 gene expression in lymphocytes compared with ones heterozygous for the haplotype (p = 0.038). Conclusions: Our data suggest that cytoplasmic FMRP interacting protein 2 are associated with the development of atopic asthma in humans, and that targeting cytoplasmic FMRP interacting protein 2 could be a novel strategy for treating atopic asthma.

Keywords: inducible tyrosine kinase; transmission disequilibrium test; polymorphism

Atopic diseases, such as asthma, atopic dermatitis, and allergic rhinitis, are major causes of morbidity in developed countries, and they have been increasing in frequency (1, 2). Asthma affects nearly 155 million individuals worldwide (3). It is a complex disorder involving genetic and environmental factors, and several asthma susceptibility loci have been identified through genomewide screens (4-10). A region of human chromosome 5q has been linked to asthma and asthma-associated phenotypes in several genomewide studies (4, 8, 10, 11). In our genomewide screen for loci associated with mite- sensitive atopic asthma, we found strong evidence for linkage of marker D5S820 to atopic asthma (10).

Our linkage region on chromosome 5q includes the mouse homologous region that contains an airway hyperreactivity regulatory locus, which contains Epsin 4, a disintegrin and metalloproteinase domain 19, Sry-box 30, cytoplasmic fragile X mental retardation protein (FMRP) interacting proteins 2 (CYFI P2), cofactor required for sp1 transcriptional activation, subunit 9, interleukin 2 (IL-2)- inducible tyrosine kinase (ITK), hepatitis virus cellular receptor 1 (HAVCR1), and HAVCR2 (12). It was reported that HAVCR1 and HAVCR2 are associated with differentiation of T-helper type 1 (Th1) and Th2 cells and airway hyperresponsiveness in mice and suggested that HAVCRs play an important role in the regulation of asthma and allergic diseases (12). Also, it was recently reported that HAV seropositivity protects against atopy only in individuals carrying an insertion/ deletion coding polymorphism in HAVCR1 (13). We previously screened for polymorphisms in HAVCR1 and HAVCR2 and identified seven, including two insertion/deletion coding polymorphisms, in HAVCR1 and two in HAVCR2. However, we did not detect any association between these polymorphisms and development of asthma (14).

Our linkage region also includes the IL-12B gene. IL-12 is a macrophage-derived cytokine that modulates T-lymphocyte responses and can suppress allergic inflammation. We performed a mutation screen of IL12B and identified four variants in IL12B; however, none of these polymorphisms was associated with development of atopic asthma (15).

In the present study, we screened for mutations in 26 genes located in the 5q33 linkage region, and we describe herein the results of transmission disequilibrium tests of the identified polymorphisms. We identified functional polymorphisms associated with asthma in our Japanese study population.

METHODS

Probands were children with mite-sensitive asthma who visited the Pediatric Allergy Clinic of the University Hospital of Tsukuba. A full verbal and written explanation of the study was given to all family members interviewed, and 155 families (538 members), including 47 families used for our genomewide screening (10), gave informed consent and participated in this study. Criteria used for the diagnosis of asthma were described previously (16).

We constructed a saturation map of our linkage region on chromosome 5q33 with 27 microsatellite markers between D5S2013 and D5S211. The 95% confidence interval was calculated based on a method described previously (17). There were 26 refseq genes in the 95% confidence interval, and we performed mutation screens of these 26 genes. All exons, exon-intron junctions, and 5' flanking regions of the 26 genes were amplified from genomic DNAs of 16 unrelated subjects with asthma. Ninety polymorphisms with minor allele frequencies of greater than 0.05 were identified. Because we found strong association between asthma and polymorphisms in CYFIP2, we screened for mutations in the region that was 2 kb upstream of exon 1 and across all of intron 1 of CYFIP2. Eighteen additional polymorphisms, including four polymorphisms in complete linkage disequilibrium with C.2061C/T, were identified in intron 1 of CYFIP2. Genotyping of all 105 polymorphisms with minor allele frequencies greater than 0.05 was done by fluorescence correlation spectroscopy (18), TaqMan Assay-on-Demand single nucleotide polymorphism typing (Applied Biosystems, Foster City, CA), or direct sequencing.

We used human multiple-tissue, human immune system, and human blood fraction cDNA panels (Clontech, PaIo Alto, CA) to analyze expression of CYFIP2 in various tissues. Primers used for polymerase chain reaction (PCR) were 5'-CATTGTCCTCGCCATAGAGG and 5'- ACGGTGGATACGGAATGATG, and the expected product size was 467 bp.

Peripheral blood lymphocytes from 18 adult donors without allergic symptoms were purified by Ficoll-Paque gradient (Amersham Pharmacia Biotech AB, Uppsala, Sweden). Naive T cells were sorted from cord blood cells, and Th1- and Th2-skewed cells were then developed in culture medium. Detailed methods are available in the online supplement. Total RNA was extracted from lymphocytes with RNeasy (Qiagen, Valencia, CA). Real-time PCR was performed with the TaqMan Universal Master Mix and Assay-on-Demand gene expression kit (Applied Biosystems) per the manufacturer's instructions. All samples were tested in triplicate, and quantification of mRNA in each sample was performed with serial-diluted reference cDNA using SDS 2.1 software (Applied Biosystems). GAPDH was analyzed as an internal control. Relative gene expression was calculated as the ratio of the target gene (CYFIP2) to the internal control (CAPDH). The difference in quantities of mRNA between genotypes was analyzed by Student's t test.

Detailed methods for electrophoretic mobility shift assays are given in the online supplement.

Statistics

Multipoint linkage analysis on chromosome 5q33 was done with the GeneHunter program (19). A family-based association test was performed with a transmission disequilibrium test as implemented in the ASPEX program (20). A haplotype association test was performed with Haploview software (21). Linkage disequilibrium was calculated and visualized with graphical overview of linkage disequilibrium, or GOLD, software (22). The p values for multiple comparisons were adjusted by Bonferroni correction, and a p value less than 0.00033 was considered statistically significant.

RESULTS

To identify asthma susceptibility genes present in the area of human chromosome 5q33, we constructed a saturation map of 27 microsatellite markers that span 23.6 Mb between D5S2013 and D5S211 (Figure 1A). A portion of the microsatellite genotype data included in constructing the saturation map was generated as part of our previous study (10). We found strong evidence (maximum lod score, 5.28) for linkage between asthma and a region between D5S487 and D5S422. The 95% confidence interval for the location of the asthma susceptibility gene was defined by markers D5S2077 and D5S1955, which are separated by 9.4 Mb according to the annotated human genome sequences. We screened for mutations in 26 genes located in this 95% confidence interval region and genotyped-90 polymorphisms with minor allele frequencies of greater than 0.05 in 538 members of 155 families with asthma. The locations of the polymorphisms and reference single nucleotide polymorphism numbers are listed in Table E2 in the online supplement. Allele frequencies of three polymorphisms found in the parents were not in Hardy-Weinberg equilibrium (rs6870491 in GLRA1, p = 0.02, rs2289852in CYFIP2, p = 0.041, and rs2277040 in FLJ25267, p = 0.008). Pairwise linkage disequilibrium between polymorphisms in the 9.4-Mb region is presented in Figure E1. Results of the transmission disequilibrium test for these 155 families with asthma are shown in Figure 1B and Figure E2. Two polymorphisms in CYFIP2 (IVS3+20G/A and C.2061C/T) showed the strongest association with the development of asthma (transmitted, 28, vs. not transmitted, 5; p \= 0.000075; odds ratio, 5.9), and these two polymorphisms were in complete linkage disequilibrium (D' and r^sup 2^ = 1; Table 1). The IVS3+20G and C.2061C alleles were transmitted preferentially to asthma-affected offspring. Linkage disequilibrium studies of polymorphisms around CYFIP2 showed that linkage disequilibrium was restricted to a region containing ITK and CYFIP2 (Figure 1C). Polymorphisms in ITK are in linkage disequilibrium with those in CYFIP2, and the A allele of ITK- IVS14-588A/G tended to be transmitted preferentially to asthma- affected offspring (transmitted, 13; not transmitted, 3; p = 0.041), although the statistical significance was not significant after correction for multiple comparisons.

Reverse transcription PCR was performed to examine whether the IVS3+20G/A and C.2061C/T polymorphisms affect splicing of CYFIP2. We designed primer pairs specific for exons 2 and 4 and for exons 16 and 20 because the IVS3+20G/A and c.2061C/T polymorphisms were located in intron 3 and exon 17, respectively. We performed reverse transcription PCR using RNAs extracted from lymphocytes of subjects homozygous or heterozygous for these alleles, and no splice variants were observed (data not shown).

To identify a causal polymorphism in the genomic region of CYFIP2, we extended our mutation screen to a region 2 kb upstream of the transcription initiation site and to intron 1. We identified 18 polymorphisms in intron 1, and four (CY-In1-4A/T, CY-In1-8T/C, CY- In1-9G/A, and CY-In1-10A/G) were in complete linkage disequilibrium with IVS3+20G/A and C.2061C/T. The results of transmission disequilibrium tests with CYFIP2 polymorphisms are shown in Table 1. Six polymorphisms in CYFIP2 were in complete linkage disequilibrium and showed strong association with asthma (p = 0.000075; Table 1 and Figure E2). We then performed haplotype association tests with the family data. The region was divided into 16 linkage disequilibrium blocks by the methods of Gabriel and colleagues (23), and a haplotype association test was performed for each linkage disequilibrium block. A total of 47 association tests were performed; however, none of the haplotypes showed stronger associations than the one observed in the single-polymorphism association test.

We next performed electrophoretic mobility shift assays with fragments containing CY-In1-8T/C, CY-In1-9G/A, or CY-In1-10A/G to assess the functional significance of the variants. CY-In1-4A/T was not evaluated because the single base-pair change AAAAAATTTTTTT to AAAAATTTTTTTT is unlikely to cause a functional difference. In electrophoretic mobility shift assays with K562 and Jurkat cell nuclear extracts, bands with retarded mobility were detected for the CY-In1-8T allele (Figure 2A, lane 1, bands a and b) but not for the CY-In1-8C allele (Figure 2A, lane 3). Binding specificity was confirmed by cross-competition with unlabeled CY-In1-8T or CY-In1- 8C. Competitive binding of CY-In1-8T, but not CY-In1-8C, eliminated DNA/ nuclear protein bindings of bands a and b (Figure 2B, lanes 13- 15). Computer prediction of a potential binding protein (Match; http://www.gene-regulation.com/) to the CY-In1-8T/C polymorphic site suggested that GATA binding proteins might have more binding affinity to CY-In1-8T than to CY-In1-8C. The competition experiment revealed that DNA/nuclear protein bindings represented by bands a and b were eliminated by the additional oligonucleotide specific to GATA binding proteins (Figure 2B, lane 16), suggesting that GATA binding proteins may differently bind to CY-In1-8T/C polymorphic site. A band with retarded mobility was observed for the CY-In1-9A allele but not for the CY-In1-9G allele (Figure 2A, band c, lanes 5 and 6); however, this was not competed with a 100-mol/L excess of cold oligonucleotide, suggesting that band c is nonspecific. A protein-DNA complex was also observed with CY-In1-10, and the intensity for the band with G allele was much stronger than that with the A allele (Figure 2A, band d, lanes 9 and 11). Because no difference of DNA/nuclear protein bindings was observed in CY-ln1- 9, and the only one strong binding was observed in CY-In1-10, we have not determined the band c in CY-In1-9 and the band d in the CY- In1-10 in the competitive electrophoretic mobility shift assay (Figure 2A). Tissue expression of CYFIP2 was analyzed by RT-PCR (Figure 3). We observed strong expression in brain, kidney, lymph nodes, lymphocytes, and thymus, and weak expression in skeletal muscle. In the human blood fraction panel (Figure 3C), CYFIP2 expression was stronger in resting cells than in activated cells. We then performed real-time PCR using RNA extracted from naive T cells, Th1-skewed cells, and Th2-skewed cells. Naive T cells derived from umbilical cord blood were cultured in an environment suitable for Th1 development (IL-12 and anti-IL-4) or in a Th2-skewed environment (IL-4 and anti-IL-12) for 9 days. On flow cytometric analysis, all naive T cells showed high expression of CD45RA. Among Th1-skewed cells, 50% were positive for IFN-γ and 1.9% were positive for IL-13. Among Th2-skewed cells, 1.7% were positive for IFN-γ and 30% were positive for IL-13. Real-time quantitative analysis revealed that CYFIP2 was expressed more in undifferentiated cells than in differentiated cells (Th0/Th1 ratio = 7.1, Th0/Th2 ratio = 2.9, and Th2/Th1 ratio = 2.4).

Figure 1. (A) Maximum logarithm of odds score (MLS) plot for asthma on human chromosome 5q33 in 47 families with asthma identified through children with mite-sensitive asthma. (6) Results of transmission disequilibrium test in the 95% confidence interval for the location of the asthma susceptibility gene for 155 families with asthma. Y axis: -log^sub 10^ (p value); X axis: location in Mb. (C) Pairwise linkage disequilibrium between polymorphisms in a 0.8- Mb region as measured by D' in 155 families with asthma. Areas indicated in red or yellow show strong linkage disequilibrium.

TABLE 1. RESULTS OF TRANSMISSION DISEQUILIBRIUM TESTS OF CYFIP2 IN FAMILIES WITH ASTHMA

Levels of expression for different haplotypes were quantified by real-time PCR. As shown in Table 1, six polymorphisms, CY-In1-4A/T, CY-In1-8T/C, CY-In1-9G/A, CY-In1-10A/G, IVS3+20G/A, and c.2061C/T, were in complete linkage disequilibrium (r^sup 2^ = 1). The mean level of CYFIP2 expression in lymphocytes from subjects homozygous for the ATGAGC haplotype (n = 9) was significantly higher than that in lymphocytes from subjects heterozygous for the ATGAGC haplotype (ATGAGC/TCAGAT, n = 9; 16.1 for homozygotes and 12.0 for heterozygotes, p = 0.038). Neither ITK nor CRSP9 expression in lymphocytes was associated with CYFIP2 haplotypes by realtime quantitative analysis (p > 0.1). The expression level of ADAM19 was too low to be detected by real-time quantitative analysis.

DISCUSSION

Our present data show that polymorphisms in the CYFIP2 gene on human chromosome 5q33 are associated with childhood atopic asthma. CYFIP2 was originally identified as a protein induced by p53 and p53 mutant protein 121F (24). The CYFIP family includes two proteins, CYFIP1 and CYFIP2, that share 88% amino acid sequence identity. The sequences of these proteins are highly conserved among species (24). CYFIP2 is expressed in various tissues, such as brain, liver, kidney, lymph nodes, and lymphocytes. Interestingly, CYFIP2 is expressed in resting cells more than in activated cells, and real- time quantitative analysis revealed that expression is stronger in undifferentiated cells than in differentiated cells. Thus, CYF1P2 may be involved in differentiation of T cells. Schenck and colleagues (25) reported that CYF1P2 interacts with FMRP and that CYFIP is involved in controlling synaptogenesis and axonogenesis and affects axonal path-finding, growth, and branching. The role of CYFIP2 in the immune system is less clear; however, Mayne and coworkers (26) showed that CYFIP2 is involved in Rac1-mediated T- cell adhesion and that overabundance of CYFIP2 protein facilitates increased adhesion of T cells obtained from patients with multiple sclerosis. Our real-time quantitative PCR analysis revealed that subjects homozygous for the ATGAGC haplotype, which was overtransmitted to asthma-affected offspring, showed a significantly increased level of CYFIP2 expression in lymphocytes compared with the expression level in subjects heterozygous for the ATGAGC haplotype. These data suggest involvement of CYFIP2 in the development of both Th2mediated asthma and Th1-mediated multiple sclerosis. CYFIP2 may be involved in a Th1/Th2 imbalance.

Transcriptional factor binding sites in intron 1 play critical roles in enhancing expression of some genes (27, 28), and polymorphisms in intron 1 in RANTES (28) and lymphotoxin a (29) are shown to bind nuclear proteins differently and are associated with HIV-1 infection and myocardial infarction, respectively. The CYFIP2 intron 1 polymorphism, CY-In1-8T/C, binds nuclear proteins differently in vitro, and the competitive experiment showed that GATA binding proteins might have more binding affinity to CY-In1-ST than to CY-In1-SC (Figures 2A and 2B, bands a and b). These findings combined with results of our real-time PCR analysis indicate that the intronic polymorphisms are important for CYFIP2 expression.

Allele frequencies of three polymorphisms of parents were not in Hardy-Weinberg equilibrium (rs6870491 in GLRA1, rs2289852 in CYFIP2, and rs2277040 in FLJ25267). We set our significance level at 0.05. In other words, deviation from Hardy-Weinberg equilibrium would be expected to occur at a frequency of 5% or less under Hardy-Weinberg equilibrium. Because we genotyped 90 polymorphisms, four polymorphisms would be expected to have p values less than 0.05 under Hardy-Weinberg equilibrium; therefore, it is possible that they occur by chance. Other reasons for the deviation include nonrandom mating and genotyping errors. Because the other 87 polymorphi\sms were in Hardy-Weinberg equilibrium, nonrandom mating is unlikely. Concerning genotyping, these three polymorphisms were analyzed by fluorescence correlation spectroscopy, and the accuracy of sequencing was confirmed by the sequence of at least 16 unrelated individuals.

There are a number of limitations to our study. First, we examined a 9.4-Mb region to identify asthma susceptibility genes. Although we calculated the 95% confidence interval region with the method of Glidden and others (17), the possibility remains that the actual susceptibility gene may be located further away from the linkage peak. Therefore, we cannot exclude the possibility that there may be other asthma susceptibility genes outside of this 9.4- Mb region on chromosome 5q33. second, our polymorphism screening did not cover the introns and intergenic regions that may contain causal variants for asthma. Regulatory regions of genes are sometimes located in introns and intergenic sequences (28, 30). We screened for mutations in exons, exonintron junctions, and promoter regions because polymorphisms in these regions are more likely to have functional effects than those in introns and intergenic sequences. However, causal variants in introns and intergenic sequences were overlooked in our present approach.

Figure 2. (A) Electrophoretic mobility shift assays of fragments of intron 1 of CYFIP2 with nuclear extracts from K562 (top) and Jurkat (bottom) cells. Fragments containing either CY-In1-8C/T, CY- In1-9C/A, or CY-In1-10A/G were synthesized and used as DNA probes. One-hundred-fold molar excess cold oligonucleotides were added in the evennumbered lanes (2, 4, 6, 8, 10, and 12). Experiments were replicated four times, and the same results were obtained in each replicate. (B) Competition experiment of the CY-In1-8T/C polymorphic site. Lane 13: CY-In1-8T without cold competitor; lane 74: CY-In1- 8T with a 100-fold molar excess of cold CY-In1-8T; lane 75: CY-In1- 8T with a 100-fold molar excess of cold CY-In1-8C; lane 16: CY-In1- 8T with a 100-fold molar excess of cold oligonucleotide specific to CATA binding proteins. Nuclear extracts from Jurkat cells were used for competition experiments. Experiments were replicated three times, and the same results were obtained in each replicate.

Because we performed multiple tests for the association analysis, appropriate corrections are necessary to avoid spurious associations. We performed 105 single-polymorphism association tests and 47 haplotype tests. We applied Bonferroni correction, one of the most stringent corrections, to this dataset, and 0.057(105 + 47) = 0.00033 was set as the p value for the α level of 0.05. The p values for six polymorphisms in CYFIP2 were 0.000075, which is statistically significant even after Bonferroni correction.

Figure 3. Expression of CYFIP2 in human multiple-tissue panels. Polymerase chain reaction (PCR) amplification of cDNA from body organs (A), immune system (B), and blood fractions (C) are shown. GAPDH was used as a control, a = activated; r = resting. The region between exons 16 and 20 was amplified. PCR products were detected in most of the tissues examined. The experiments were repeated three times, and the pattern of PCR bands was the same in each experiment.

McIntire and coworkers (12) examined congenic mice that differed only at a segment homologous to human 5q23-35, and they identified a region related to the development of bronchial hyperresponsiveness and T-cell production of IL-4 and IL-13. The region includes several candidate genes for asthma, such as ITK, HAVCR1, and HAVCR2. The A polymorphisms in ITK are in linkage disequilibrium with those in CYFIP2, and the A allele of ITK-IVS14-588A/G tended to be transmitted preferentially to asthma-affected offspring (transmitted, 13; not transmitted, 3; p = 0.041). It has been shown that the genomic regions harboring regulatory elements can stretch as much as 1 Mb in either direction from the transcription unit, and that some elements may reside within the introns of neighboring genes (31, 32). ITK is a member of the tec family of kinases and is critical for both development and activation of T cells. Mice lacking ITK have drastically reduced lung inflammation, eosinophil infiltration, and mucosal production after induction of allergic asthma (33), and a recent study showed that selective ITK inhibitors block T-cell activation and lung inflammation in ovalbumininduced mice (34). In the present study, the strongest association was observed between polymorphisms in CYFIP2 and atopic asthma. CYFIP2 is located adjacent to ITK and in the chromosome region related to mouse bronchial hyperresponsiveness. Therefore, it is possible that CYFIP2 is an evolutionary-conserved locus that affects bronchial hyperresponsiveness in both humans and mice. However, involvement of ITK in the development of asthma in the Japanese population cannot be excluded.

In summary, we identified CYFIP2 as a susceptibility gene for childhood-onset atopic asthma by means of a family-based association test. Also, the CYFIP2 haplotypes are associated with its expression levels, suggesting CYFIP2 expression is controlled genetically to some extent. CYFIP2 plays a role in adhesion of T cells, and further investigation of CYFIP2 could clarify the mechanisms underlying the development of asthma.

Conflict of Interest Statement: None of the authors have a financial relationship with a commercial entity that has an interest in the subject of this manuscript.

Acknowledgment: The authors thank Drs. Satoko Nakahara, Tetsuo Nogami, and Michiharu Inudou for collecting samples, and all family members who participated in the study.

References

1. International Study of Asthma and Allergies in Childhood Steering Committee. Worldwide variation in prevalence of symptoms of asthma, allergic rhinoconjunctivitis, and atopic eczema. Lancet 1998;351:1225-1232.

2. Gergen PJ, Weiss KB. The increasing problem of asthma in the United States. Am Rev Respir Dis 1992;146:823-824.

3. Hoffjan S, Ober C. Present status on the genetic studies of asthma. Curr Opin Immunol 2002;14:709-717.

4. Collaborative Study on the Genetics of Asthma. A genome-wide search for asthma susceptibility loci in ethnically diverse populations: the Collaborative Study on the Genetics of Asthma (CSGA). Nat Genet 1997;15:389-392.

5. Daniels SE, Bhattacharrya S, James A, Leaves NI, Young A, Hill MR, Faux JA, Ryan GF, le Souef PN, Lathrop GM, et al. A genome-wide search for quantitative trait loci underlying asthma. Nature 1996;383: 247-250.

6. Dizier MH, Besse-Schmittler C, Guilloud-Bataille M, Annesi- Maesano I, Boussaha M, Bousquet J, Charpin D, Degioanni A, Gormand F, Grimfeld A, et al. Genome screen for asthma and related phenotypes in the French EGEA study. Am J Respir Crit Care Med 2000;162:1812-1818.

7. Laitinen T, Daly MJ, Rioux JD, Kauppi P, Laprise C, Petays T, Green T, Cargill M, Haahtela T, Lander ES, et al. A susceptibility locus for asthma-related traits on chromosome 7 revealed by genome- wide scan in a founder population. Nat Genet 2001;28:87-91.

8. Ober C, Cox NJ, Abney M, Di Rienzo A, Lander ES, Changyaleket B, Gidley H, Kurtz B, Lee J, Nance M, et al. Genome-wide search for asthma susceptibility loci in a founder population: the Collaborative Study on the Genetics of Asthma. Hum Mol Genet 1998;7:1393-1398.

9. Wjst M, Fischer G, Immervoll T, Jung M, Saar K, Rueschendorf F, Reis A, Ulbrecht M, Gomolka M, Weiss EH, et al. A genome-wide search for linkage to asthma: German Asthma Genetics Group. Genomics 1999;58:1-8.

10. Yokouchi Y, Nukaga Y, Shibasaki M, Noguchi E, Kimura K, Ito S, Nishihara M, Yamakawa-Kobayashi K, Takeda K, Imoto N, et al. Significant evidence for linkage of mite-sensitive childhood asthma to chromosome 5q31-q33 near the interleukin 12 B locus by a genomewide search in Japanese families. Genomics 2000;66:152-160.

11. Xu J, Postma DS, Howard TD, Koppelman GH, Zheng SL, Stine OC, Bleecker ER, Meyers DA. Major genes regulating total serum immunoglobulin E levels in families with asthma. Am J Hum Genet 2000; 67:1163-1173.

12. McIntire JJ, Umetsu SE, Akbari O, Potter M, Kuchroo VK, Barsh GS, Freeman GJ, Umetsu DT, DeKruyff RH. Identification of Tapr (an airway hyperreactivity regulatory locus) and the linked Tim gene family. Nat Immunol 2001;2:1109-1116.

13. McIntire JJ, Umetsu SE, Macaubas C, Hoyte EG, Cinnioglu C, CavalliSforza LL, Barsh GS, Hallmayer JF, Underhill PA, Risch NJ, et al. Immunology: hepatitis A virus link to atopic disease. Nature 2003;425: 576.

14. Noguchi E, Nakayama J, Kamioka M, Ichikawa K, Shibasaki M, Arinami T. Insertion/deletion coding polymorphisms in hHAVcr-1 are not associated with atopic asthma in the Japanese population. Genes Immun 2003;4:170-173.

15. Noguchi E, Yokouchi Y, Shibasaki M, Kamioka M, Yamakawa- Kobayashi K, Matsui A, Arinami T. Identification of missense mutation in the IL12B gene: lack of association between IL12B polymorphisms and asthma and allergic rhinitis in the Japanese population. Genes lmmun 2001;2:401-403.

16. Noguchi E, Shibasaki M, Inudou M, Kamioka M, Yokouchi Y, Yamakawa-Kobayashi K, Hamaguchi H. Matsui A, Arinami T. Association between a new polymorphism in the activation-induced cytidine deaminase gene and atopic asthma and the regulation of total serum IgE levels. J Allergy Clin Immunol 2001;108:382-386.

17. Glidden DV, Liang KY, Chiu YF, Pulver AE. Multipoint affected sibpair linkage methods for localizing susceptibility genes of complex diseases. Genet Epidemiol 2003;24:107-117.

18. Bannai M, Higuchi K, Akesaka T, Furukawa M, Yamaoka M, Sato K, Tokunaga K. Single-nucleotide-polymorphism genotyping for whole- genome-amplified samples using automated fluorescence correlation spectroscopy. Anal Biochem 2004;327:215-221.

19. Kruglyak L, Daly MJ, Reeve-Daly MP, Lander ES. Parametric and non-parametric linkage analysis: a unified multipoint approach. Am J Hum Genet 1996;58:1347-1363.

2\1. Risch N, Spiker D, Lotspeich L, Nouri N, Hinds D, Hallmayer J, Kalaydjieva L, McCague P, Dimiceli S, Pitts T, et al. A genomic screen of autism: evidence for a multilocus etiology. Am J Hum Genet 1999;65: 493-507.

21. Barrett JC, Fry B, Mailer J, Daly MJ. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 2004;5:5.

22. Abecasis GR, Cookson WO. GOLD: graphical overview of linkage disequilibrium. Bioinformatics 2000;16:182-183.

23. Gabriel SB, Schaffner SF, Nguyen H, Moore JM, Roy J, Blumenstiel B, Higgins J, DcFelice M, Lochner A, Faggart M, et al. The structure of haplotype blocks in the human genome. Science 2002;296:2225-2229.

24. Saller E, Tom E, Brunori M, Otter M, Estreicher A, Mack DH, Iggo R. Increased apoptosis induction by 121F mutant p53. EMBO J 1999; 18:4424-4437.

25. Schenck A, Bardoni B, Moro A, Bagni C, Mandel JL. A highly conserved protein family interacting with the fragile X mental retardation protein (FMRP) and displaying selective interactions with FMRP-related proteins FXR1P and FXR2P. Proc Natl Acad Sci USA 2001;98:8844-8849.

26. Mayne M, Moffatt T, Kong H, McLaren PJ, Fowke KR, Becker KG, Namaka M, Schenck A, Bardoni B, Bernstein CN, et al. CYFIP2 is highly abundant in CD4+ cells from multiple sclerosis patients and is involved in T cell adhesion. Eur J Immunol 2004;34:1217-1227.

27. Handen JS, Rosenberg HF. Intronic enhancer activity of the eosinophilderived neurotoxin (RNS2) and eosinophil cationic protein (RNS3) genes is mediated by an NFAT-1 consensus binding sequence. J Biol Chem 1997;272:1665-1669.

28. An P, Nelson GW, Wang L, Donfield S, Goedert JJ, Phair J, Vlahov D, Buchbinder S, Farrar WL, Modi W, et al. Modulating influence on HIV/AIDS by interacting RANTES gene variants. Proc Natl Acad Sci USA 2002;99:10002-10007.

29. Ozaki K, Ohnishi Y, Iida A, Sekine A, Yamada R, Tsunoda T, Sato H, Hori M, Nakamura Y, Tanaka T. Functional SNPs in the lymphotoxin-alpha gene that are associated with susceptibility to myocardial infarction. Nat Genet 2002;32:650-654.

30. Loots GG, Locksley RM, Blankespoor CM, Wang ZE, Miller W, Rubin EM, Frazer KA. Identification of a coordinate regulator of interleukins 4, 13, and 5 by cross-species sequence comparisons. Science 2000;288: 136-140.

31. Lettice LA, Horikoshi T, Heaney SJ, van Baren MJ, van der Linde HC, Breedveld GJ, Joosse M, Akarsu N, Oostra BA, Endo N, et al. Disruption of a long-range cis-acting regulator for Shh causes preaxial polydactyly. Proc Natl Acad Sci USA 2002;99:7548-7553.

32. Kleinjan DA, Seawright A, Schedl A, Quinlan RA, Danes S, van Heyningen V. Aniridia-associated translocations, DNase hypersensitivity, sequence comparison and transgenic analysis redefine the functional domain of PAX6. Hum Mol Genet 2001;10:2049- 2059.

33. Mueller C, August A. Attenuation of immunological symptoms of allergic asthma in mice lacking the tyrosine kinase ITK. J Immunol 2003;170: 5056-5063.

34. Lin TA, McIntyre KW, Das J, Liu C, O'Day KD, Penhallow B, Hung CY, Whitney GS, Shuster DJ, Yang X, et al Selective itk inhibitors block T-cell activation and murine lung inflammation. Biochemistry 2004;43:11056-11062.

Emiko Noguchi, Yukako Yokouchi, Jiang Zhang, Kazuko Shibuya, Akira Shibuya, Makoto Bannai, Katsushi Tokunaga, Hitomi Doi, Mayumi Tamari, Makiko Shimizu, Taro Shirakawa, Masanao Shibasaki, Kunio Ichikawa, and Tadao Arinami

Departments of Medical Genetics, Pediatrics, and Immunology, Graduate School of Comprehensive Human Sciences, University of Tsukuba; Department of Pediatrics, Tsukuba College of Technology; Tsukuba Medical Center Hospital, Tsukuba; Department of Human Genetics, Graduate School of Medicine, University of Tokyo, Tokyo; and Laboratory of Genetics of Allergic Diseases, RIKEN SNP Research Center, Yokohama, Japan

(Received in original form September 16, 2004; accepted in final form April 17, 2005)

Supported by scientific research grants (12204001 and 12024201) from the Ministry of Education, Science, and Culture of Japan.

Correspondence and requests for reprints should be addressed to Emiko Noguchi, M.D., Ph.D., Department of Medical Genetics, Graduate School of Comprehensive Human Sciences, University of Tsukuba, 1-1- 1 Tennoudai, Tsukuba, Ibaraki-ken, 305-8577, japan. E-mail: enoguchi@md.tsukuba.ac.jp

This article has an online supplement, which is accessible from this issue's table of contents at www.atsjournals.org

Am J Respir Crit Care Med Vol 172. pp 183-188, 2005

Originally Published in Press as DOI: 10.1164/rccm.200409-1223OC on May 5, 2005

Internet address: www.atsjournals.org

Copyright American Thoracic Society Jul 15, 2005


Source: American Journal of Respiratory and Critical Care Medicine

More News in this Category


Related Articles



Rating: 3.7 / 5 (10 votes)
Rate this article:
1/52/53/54/55/5

User Comments (0)

Comment on this article

Your Name
Text from the image
Comment
max 1200 chars
* All fields are required