Quantcast
Last updated on May 29, 2012 at 17:24 EDT

In Vitro Estrogenic Activity of Formononetin By Two Bioassay Systems

January 5, 2007
Repost This

By Ji, Zhao-Ning; Zhao, W Y; Liao, G R; Choi, R C; Et al

Abstract

Aim. To study the estrogenic activity of formononetin in vitro.

Methods. We have established a highly sensitive bioassay system by placing estrogen-responsive elements upstream of the luciferase reporter gene, and used this assay to determine the estrogenic activity of formononetin. Cell growth was measured by the MTT (3- (4,5-dimethylthioazol-2-yl)-2,5-diphenyltetrazolium bromide) assay and MG-63 cell function was studied by measuring alkaline phosphatase activity.

Results. Formononetin activated expression of the estrogen- responsive reporter gene in human breast cell line MCF-7 in a concentration-dependent manner (0.5-500 M), and this activation was inhibited by estrogen antagonist (ICI 182780 at 100 nM). Furthermore, it induced the proliferation of MCF-7 breast cancer cells and MG-63 osteosarcoma cells, and it also increased the alkaline phosphatase activity in MG-63 cells.

Conclusion. Formononetin is a phytoestrogen that exhibits variable degrees of estrogen receptor agonism in different test systems.

Keywords: Formononetin, transfection, MCF7-ERE cell, MG-63 cell estrogenic activity, alkaline phosphatase

Introduction

During the period of menopause and postmenopause, many women experience one or more symptoms such as hot flushes, depression, mood wings, sleeping disorders, vaginal dryness, and joint pain, largely due to a lack of estrogen. Hormone replacement therapy (HRT) helps to relieve menopausal symptoms; in addition, the risk of osteoporosis, cardiovascular disease, dementia from Alzheimer’s disease and certain types of cancer is reduced [1]. However, despite the beneficial effects of estrogen replacement therapy on cognition, estrogen use in postmenopausal women is associated with increased risks of uterine cancer and potentially an increase in neoplasms of the breast, especially after long-term use. In contrast, several reports indicate that phytoestrogens do not promote neoplasms of the breast and uterus, but instead reduce the risk of developing several types of cancer, most notably breast cancer.

Phytoestrogen-associated risk reduction of breast cancer is of critical significance not only for the potential of reducing breast cancer incidence, but also because the specter of breast cancer has a significant and pervasive influence in health choices that impact on other disease risks. There has been tremendous interest in the possibility that phytoestrogens may be an alternative to postmenopausal HRT, because concerns about side-effects and long- term health consequences prevent many women from using HRT for amelioration of the discomforts and increased disease risk associated with the menopausal transition [2-4].

Radix Astragali (root of Astragalus; Huangqt), a common traditional Chinese medicine, has been proved to be an immunostimulant, tonic (adaptogenic), hepatoprotective, diuretic, antidiabetic, analgesic, expectorant and sedative drug [5,6]. Although Radix Astragali has a long history of use in Chinese herbal medicine, its pharmacological properties and clinical applications have not been studied until recently. Radix Astragali has been demonstrated to have a wide range of immunopotentiating effects and has been used as an adjunct medicine during cancer therapy [7]. Formononetin is an active component extracted from this herb, but there is little basic information about the pharmacological effects of formononetin. In the present study, the estrogenic activity of formononetin was analyzed. The ability of formononetin to increase estrogen-dependent MCF-7 human breast cancer cells was measured at several different concentrations. Also, the effect of formononetin on the estrogen receptor (ER) was examined using stably transfected MCF-7 cells. Moreover, the effects of formononetin on human osteosarcoma MG-63 cell growth and alkaline phosphatase (ALP) activity were investigated.

Methods

Materials

Formononetin (purity >95%) was purchased from National Institute for the Control of Pharmaceutical and Biological Products, China (Figure 1). Cell culture reagents were obtained from Gibco RBL (Grand Island, NY, USA). 170-Estradiol (1,3,5[10]estratriene-3,17 β-diol), 3-(4,5-dimethylthioazol-2-yl)2,5-diphenyltetrazolium bromide (MTT) and p-nitrophenyl phosphate (PNPP) were purchased from Sigma Chemical Co. (St. Louis, MO, USA). All other chemicals were of analytical grade. Each concentration of the test chemicals and 17 β-estradiol was prepared in dimethyl sulfoxide as a 1000-fold stock solution for screening in the in vitro bioassays.

Plasmid construction

For construction of the estrogen-responsive reporter plasmid, two primers, 5′-GGTCACAGTGACCGC GGCCGCTCTACAGTCGACGGTCACAGTGA CC-3′ and 5′-GGTCACTGTGACCGTCGACTG TAGAGCGGCCGCGGTCACTGTGACC-3′ (underlined: estrogen-responsive element (ERE), bold: Nod site) containing two EREs [8], were annealed and subcloned into pTA-Luc luciferase reporter vector (BD Biosciences Clontech) to form pERELuc. The plasmid DNAs encoding various constructs were purified by Qiagen column.

Figure 1. Chemical structure of formononetin.

Cell cultures and stable transfection

Human breast cancer cells, MCF-7, and osteosarcoma cells, MG-63, were obtained from the American Type Culture Collection and grown in modified Eagle’s medium (MEM) supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, 0.1 mM non-essential amino acid, 1 mM pyruvate, 100 units penicillin/ml and 100 g streptomycin/ml in an incubator containing humidified CO2 (5%) at 37C. Prior to the beginning of each experiment, all cells were grown in estrogen-free media for at least 2 days. Estrogen-free media substituted phenol redfree MEM and 10% heat-inactivated 3 charcoalstripped FBS. To establish stable transfection, MCF-7 cells were transfected by the standard calcium phosphate method [9], followed by selection with G418 (CalBiochem). The identity of pERELuc stably transfected MCF-7 was confirmed by estrogen-induced luciferase activity.

Luciferase assays

Protein concentration was measured routinely using the Bradford (1976) method with a Bio-Rad Protein Assay Kit (Bi-Rad Laboratories, Richmond, CA, USA). Luciferase assay was performed according to the kit supplied. In brief, drug-treated and cDNAtransfected MCF-7 cells were washed with phosphatebuffered saline (PBS) and resuspended in 0.2% Triton X-100, 1 mM dithiothreitol and 100 mM potassium phosphate buffer (pH 7.8). Ten microliters of lysate were taken for the luciferase assay using 17/?-estradiol as positive control. The luminescent reaction was quantified by a Tropix TR717 microplate luminometer (Tropix, Bedford, MA, USA) and the activity was expressed as absorbance per mg of protein.

Growth assay

MCF-7 cells were seeded into a 96-well plate (2 10^sup 3^ cells/ well) in 100 l of estrogen-free medium on day O (dO). The following day (dl) this medium was removed, and 100 l of medium containing the appropriate compound were added. All compounds were dissolved in dimethyl sulfoxide and added to media at a 1:1000 dilution. Medium was changed on d5 with a fresh aliquot containing the appropriate stimulus, and experiments were ended on d8. MG-63 cells were treated with medium containing the appropriate compound for 72 h. Cell growth was determined by the MTT assay, as described previously [10]. Absorbance at 570 nm was measured using a microplate reader (Dynatech MR5000). All experiments were performed in triplicate.

Alkaline phosphatase activity

ALP activity in MG-63 cells was measured by the hydrolysis of PNPP [U]. Briefly, cells were plated in 33-mm dishes and incubated with phenol red-free medium plus 10% charcoal-stripped FBS. After 48 h, cells were washed with ice-cold PBS (pH 7.4), scraped into 0.2 ml of 0.1% Triton X-100, and rapidly frozen and thawed three times to complete the lysis. One hundred microliters of the homogenate were added to the substrate solution (100 l), which contained 10 mM PNPP in 100 mM diethanolamine buffer (pH 10.5) supplemented with 0.5 mM MgCl^sub 2^. After 30 min of incubation at 37C, the reaction was terminated by addition of 100 l of 2 M NaOH, and ALP was determined spectrophotometrically (405 nm) by measuring p-nitrophenol released from the substrate. Total protein was measured with the Bio-Rad Protein Assay Kit (Bio-Rad Laboratories). Enzyme activity was expressed as mol of substrate cleaved per mg of cell protein.

Statistical analysis

Results are expressed as mean standard error of the mean and evaluated by analysis of variance.

Results

Determination of the responsiveness of the reporter gene in stably transfected MCF-7 cells

In order to determine the sensitivity of the assay system to estrogenic compounds, the prototypic agonist (17 β-estradiol) for the ER was assayed for its ability to induce expression of the luciferase reporter. Figure 2 shows the dose-dependent induction of luciferase activity when challenged with various concentrations of estrogen. Maximal activation of the transfected MCF-7 cells was achieved at 17 β-estradiol concentration of 10 nM, which resulted in a 3.28-fold induction of luciferase activity compared with control. The estrogen antagonist ICI 182780 (100 nM) inhibited reporter gene activation by 17 β-estradiol.

Figure 2. Activation of estrogen-responsive reporter plasmids by 17 β-estradiol in MCF-7 cells. In this experiment, MCF-7 cells were \treated with various concentrations of 17 β-estradiol (E; 0.001-1000 nM) for 48 h in the absence or presence of ICI 182780 (100 nM). Data are means, with standard error of the mean shown by vertical bars, of three separate experiments performed in triplicate. Mean values were significantly different compared with the control group: *p < 0.05, **p < 0.01.

Transcriptional activity of formononetin in transfected MCF-7 cells

Transfected MCF-7 cells were treated with various concentrations of formononetin or with 17 β-estradiol (10 nM) for 48 h. The transcriptional activity of formononetin increased in a dose- dependent (0.5-500 M) manner in the absence or presence of ICI 182780 at 100 nM, reaching 83.15% (5.87%) of the 17 β- estradiol (10 nM) response at 500 M (Figure 3).

Effect of formononetin on the growth of MCF-7 cells

MCF-7 cells, an estrogen-dependent breast cancer cell line, were used to examine the effects of formononetin and 17 β-estradiol on cell growth. As shown in Figure 4, formononetin significantly stimulated the growth of MCF-7 cells in a concentrationdependent (0.5-500 M) manner. To determine whether the induced cell proliferation was mediated via an ER-dependent mechanism, each formononetin dose was tested in combination with the pure estrogen antagonist ICI 182780 (100 nM) (Figure 4).

Figure 3. Transcriptional activation by formononetin is estrogen receptor-mediated. MCF-7 cells were transfected with pERE-Luc, incubated with the indicated concentrations of formononetin (F; 0.5- 500 M) or estradiol (E; 10 nM) in the absence or presence of ICI 182780 (100 nM), and assayed for luciferase activity. Data are means, with standard error of the mean shown by vertical bars, of three separate experiments performed in triplicate. Mean values were significantly different compared with the control group: *p < 0.05, **p < 0.01.

Figure 4. Effect of formononetin on the growth of MCF-7 cells. MCF-7 cells were cultured for 8 days in the presence of 17β- estradiol (E; 10 nM) or formononetin (F; 0.5-500 M) with or without ICI 182780 (100 nM) or in control medium. Data are means, with standard error of the mean shown by vertical bars, of three separate experiments performed in triplicate. Mean values were significantly different compared with the control group: *p < 0.05, **p < 0.01.

Effect of formononetin on the growth of MG-63 cells

The effect of formononetin on the proliferation of human osteosarcoma MG-63 cells was also investigated using the MTT assay. MG-63 cells were treated with various concentrations of formononetin (0.5-500 M) or with 17β-estradiol (10 nM) for 72 h. Formononetin significantly stimulated the growth of MG-63 cells in a concentration-dependent (0.5-500 M) manner (Figure 5).

Effect of formononetin on osteoblastic cell differentiation

Subconfluent cultures were treated with formononetin and assayed for cell-associated ALP activity, which is a marker of bone differentiation. As shown in Figure 6, estrogen significantly increased ALP activity. In cultures treated with formononetin (0.5- 500 M) for 72 h, a concentration-dependent significant increase in ALP activity was also observed compared with untreated cells.

Discussion

Formononetin is an isoflavone with known estrogenlike activity, which is metabolized to daidzein – the metabolically active compound – under cell-specific metabolic activation [12-14]. By using several different assay systems in the present study, we have demonstrated that formononetin is a phytoestrogen. It activated the expression of estrogen-responsive reporter gene in human breast MCF-7 cell line, and this activation was inhibited by the estrogen antagonist ICI 182780. Furthermore, it induced the proliferation of MCF-7 breast cancer cells and MG-63 osteosarcoma cells, and it also increased the ALP activity in MG-63 cells.

Figure 5. Effect of formononetin on the growth of MG-63 cells as determined by MTT (3-(4,5-dimethylthioazol-2-yl)-2,5- diphenyltetrazolium bromide) assay. Cells were treated with various concentrations of formononetin (F; 0.5-500 M) or with 17β- estradiol (E; 10 nM) for 72 h. Data are means, with standard error of the mean shown by vertical bars, of three separate experiments performed in triplicate. Mean values were significantly different compared with the control group: *p < 0.05, **p < 0.01.

Figure 6. Regulation of alkaline phosphatase (ALP) activity by estrogen and formononetin in MG-63 cells. Cells were subsequently treated with 17β-estradiol (E; 10 nM) of formononetin (F; 0.5- 500 M) for 72 h. Each treatment was performed in triplicate; data means, with standard error of the mean shown by vertical bars, of three separate experiments expressed as a percentage of the control value. Mean values were significantly different compared with the control group: *p < 0.05, **p < 0.01.

Estrogens have been shown to exert a variety of beneficial effects in men and women. They are recognized to protect against postmenopausal symptoms, osteoporosis, heart attack and other cardiovascular problems, and possibly Alzheimer’s disease. Diphenolic phytoestrogens are plant substances that show some structural similarity to 17β-estradiol and that bind to the ER, producing estrogenic effects. Studies performed in vitro and on animal models have revealed that these substances binding to the ER exert hormonal and/or antihormonal effects. Recently, mounting evidence suggests that plant-derived estrogens (phytoestrogens) may exert beneficial effects on the above-mentioned chronic diseases [15,16]. Our experiments using in vitro models demonstrated the phytoestrogenic effect of formononetin.

Bioassay using reporter genes has certain advantages. In contrast to immunoassay, it is more sensitive and requires smaller amounts of sample than an in vivo assay. A reporter gene system capable of detecting the presence of chemicals with estrogenlike activity requires a host cell that expresses the ER or can be transfected with a vector expressing ER. MCF-7 cell line was chosen for this study because it expresses ER. Unlike other bioassays that have been developed for assessing exogenous estrogenic compounds, the reporter gene assay possesses the unique advantage of allowing detection of variations in estrogen responsiveness, sensitivity and specificity that exist between ER encoded by different species. This aspect of the assay is relevant for the purposes of assessing the presence of phytoestrogens in both natural products and traditional Chinese medicines that may possess potential applications [17,18].

The proliferation of MCF-7 cells is a wellestablished biological response to estrogen and a useful screening tool for compounds that may function as estrogen agonists [19,2O]. Additionally, estrogen- induced proliferation can be blocked by the addition of antiestrogenic compounds such as ICI 182780 or tamoxifen [21]. Here we demonstrated that estrogen alone was capable of stimulating MCF7 cell proliferation, as measured using the MTT assay. To verify that the increase in cell growth was due to an estrogen-like response, we utilized the pure estrogen antagonist ICI 182780. In all studies, ICI 182780 (100 nM) blocked the induction of estrogendependent cell proliferation by formononetin. This suggests that the increase of estrogen-stimulated MCF-7 cell proliferation by formononetin is due to the estrogenic activities of formononetin.

Osteoporosis associated with estrogen deficiency is the most common cause of age-related bone loss. HRT can resolve most postmenopausal problems. However, compliance with HRT is poor because of its associated risks of breast and endometrial cancers with long-term use [22,23]. In the search for an alternative treatment, the potential health benefits of phytoestrogens have been suggested [24,25]. There is considerable evidence indicating that phytoestrogens, like certain selective estrogen receptor modulators, have estrogenic action on bone and the cardiovascular system, and have antiestrogenic action on the breast and uterus [26]. Phytoestrogens have been proposed to prevent bone rsorption and promote bone density. Especially, the beneficial effects of phytoestrogens on bone maintenance are under active evaluation. Several recent reports indicate that phytoestrogen prevents bone loss associated with the reduction of endogenous estrogen occurring in postmenopausal women and experimentally in ovariectomized animals [27-29]. Besides soy isoflavones, limited data are available on the bone-protecting effects of phytoestrogens from other plants. In the present study, we observed that formononetin significantly increased proliferation and ALP activity of human osteosarcoma cells MG-63.

In conclusion, the data presented here demonstrate the estrogenic effect of formononetin. Formononetin may be available as a lead compound for phytoestrogen agents that can offer estrogenic activity as well as treatment of postmenopausal symptoms, osteoporosis and other cardiovascular diseases. However, further studies are required to determine the mechanism by which formononetin possesses its estrogenic effect.

Acknowledgement

This study was partly supported by a hospital grant from Yijishan Hospital, Wannan Medicial awarded to Dr Ji, which the authors gratefully acknowledge.

References

1. Rymer J, Wilson R, Ballard K. Making decisions about hormone replacement therapy. Br Med J 2003;326:322-326.

2. Kurzer MS. Phytoestrogen supplement use by women. J Nutr 2003;133:1983S-1986S.

3. Setchell KDR. Soy isoflavones – benefits and risks from nature’s selective estrogen receptor modulators (SERMs). J Am Coll Nutr 2001;20:354S-362S.

4. Glazier MG, Bowman MA. A review of the evidence for the use of phytoestrogens as a replacement for traditional estrogen replacement therapy. Arch Intern Med 2001;161:1161-1172.

5. Sinclair S. Chinese herbs: a clinical review of Astragalus, Ligusacum, and Schizandrae. Altern M\ed Rev 1998;3:338-344.

6. The State Pharmacopoeia Commission of P.R. China. Pharmacopoeia of the People’s Republic of China. Beijing: Chemical Industry Press; 2000. p 161.

7. Zee-Cheng RK. Shi-quan-da-bu-tang (ten significant tonic decoction), SQT. A potent Chinese biological response modifier in cancer immunotherapy, potenuation and detoxification of anticancer drugs. Methods Find Exp Clin Pharmacol 1992;14:725-736.

8. Miller S, Kennedy D, Thomson J, Han F, Smith R, Ing N, Piedrahita J, Busbee D. A rapid and sensitive reporter gene that uses green fluorescent protein expression to detect chemicals with estrogenic activity. Toxicol Sei 2000;55:69-77.

9. Siow NL, Choi PC, Cheng AW, Jiang JX, Wan DC, Zhu SQ, Tsim KW. A cyclic AMP-dependent pathway regulates expression of acetylcholinesterase during myogenic differentiation of C2C12 cells. J Biol Chem 2002;277:36129-36136.

10. Ji ZN, Ye WC, Liu GQ, Huang Y. Inhibition of telomerase activity and bcl-2 expression in berbamine-induced apoptosis in HL- 60 cells. Plant Med 2002;68:596-600.

11. Ibbotson KJ, Harrod J, Gowen M, D’Souza S, Smith DD, Winkler ME, Derynck R, Mundy GR. Human recombinant transforming growth factor alpha stimulates bone resorption and inhibits formation in vitro. Proc Nad Acad Sei USA 1986;83:2228-2232.

12. Kuiper GG, Lemmen JG, Carlsson B, Corton JC, Safe SH, van der Saag PT, van der Burg B, Gustafsson J-A. Interaction of estrogenic chemicals and phytoestrogens with estrogen receptor 0. Endocrinology 1998;139:4252-4263.

13. Lupu R, Mehmi I, Atlas E, Tsai MS, Pisha E, Oketch-Rabah HA, Nuntanakorn P, Kennelly EJ, Kronenberg F. Black cohosh, a menopausal remedy, does not have estrogenic activity and does not promote breast cancer cell growth. Im J Oncol 2003;23:1407-1412.

14. Booth NL, Overk CR, Yao P, Totura S, Deng Y, Hedayat AS, Bolton JL, Pauli GF, Farnsworth NR. Seasonal variation of red clover (Trifolium pratense L., Fabaceae) isoflavones and estrogenic activity. J Agric Food Chem 2006;54:1277-1282.

15. Knihgt DC, Eden JA. A review of the clinical effects of phytoestrogens. Obstet Gynecol 1996;87:897-904.

16. Brandi ML. Natural and synthetic isoflavones in the prevention and treatment of chronic diseases. Calcif Tissue Int 1997;61:S5-S8.

17. Shiizaki K, Goto K, Ishige A, Komatsu Y. Bioassay of phytoestrogen in herbal medicine used for postmenopausal disorder using transformed MCF-7 cells. Phytother Res 1999; 13:498503.

18. Miller-Martini DM, Chan RYK, Ip NY, Sheu SJ, Wong YH. A reporter gene assay for the detection of phytoestrogens in traditional Chinese medicine. Phytother Res 2001;15:487492.

19. Klotz DM, Beckman BS, Hill SM, McLachlan JA, Walters MR, Arnold SF. Identification of environmental chemicals with estrogenic activity using a combination of in vitro assays. Environ Health Perspect 1996;104:84-89.

20. Wiese TE, Kral LG, Dennis KE, Butler WB, Brooks SC. Optimization of estrogen growth in MCF-7 cells. In Vitro Cell DevBiol 1992;28A:595-602.

21. Gehm BD, McAndrew JM, Chien PY, Jameson JL. Resveratrol, a polyphenolic compound found in grapes and wine, is an agonist for the estrogen receptor. Proc Natl Acad Sei USA 1997;94:14138-14143.

22. Genant HK, Baylink DJ, Gallagher JC. Estrogens in the prevention of osteoporosis in postmenopausal women. Am J Obstet Gynecol 1989; 161:1842-1846.

23. Persson I, Weiderpass E, Bergkvist L, Bergstrom R, Schairer C. Ricks of breast and endometrial cancer after estrogen-progestin replacement. Cancer Causes Control 1999;10:253-260.

24. Anderson JB, Garner SC. The effects of phytoestrogens on bone. NutrRes 1997; 17:1617-1632.

25. Tham DM, Gardner CD, Haskell WL. Clinical review 97: potential health benefits of dietary phytoestrogens: a review of the clinical, epidemiological, and mechanistic evidence. Eur J Clin Nutr 1998;52:850-855.

26. Brzezinski A, Debi A. Phytoestrogens: the ‘natural’ selective estrogen receptor modulators? Eur J Obstet Ggynecol Reprod Biol 1999;85:47-51.

27. Alekel DL, Germain AS, Peterson CT, Hanson KB, Stewart JW, Toda T. Isoflavone-rich soy protein isolate attenuates bone loss in the lumbar spine of perimenopausal women. Am J CHn Nutr 2000;72:844- 852.

28. Ishimi Y, Arai N, Wang X, Wu J, Umegaki K, Miyaura C, Takeda A, Ikegami S. Difference in effective dosage of genistein on bone and uterus in ovariectomized mice. Biochem Biophys Res Commun 2000;274:697-701.

29. FantiP, Monier-Faugere MC, Geng Z, Schmidt J, Morris PE, Cohen D, Malluche HH. The phytoestrogen genistein reduces bone loss in short-term ovariectomized rats. Osteoporos Int 1998;8:274-281.

ZHAO-NING JI1, W. Y. ZHAO1, G. R. LIAO2, R. C. CHOI3, C. K. LO3, T. T. X. DONG3, & K. W. K. TSIM3

1 Department of Oncology, Yijishan Hospital, Wannan Medical College, Wuhu, China, 2 Department of Pharmacy, Guangdong

Provincial People’s Hospital, Guangzhou, China, and 3 Department of Biology, The Hong Kong University of Science and

Technology, Hong Kong SAR, China

(Accepted 25 July 2006)

Correspondence: Z.-N. Ji, Department of Oncology, Yijishan Hospital, Wannan Medical College, Wuhu, Anhui Province, 241001 People’s Republic of China.

Tel: 86 553 5739311. Fax: 86 553 5739311. E-mail: jzning@hotmail.com

Copyright Taylor & Francis Ltd. Oct 2006

(c) 2006 Gynecological Endocrinology. Provided by ProQuest Information and Learning. All rights Reserved.