Isolation, Culture, and Characterization of Canine Sertoli Cells

By Davidson, Ashley G Bell, Rebecca J; Lees, George E; Murphy, Keith E

Abstract Primary Sertoli cell cultures have been established from several animals including the sheep and rhesus monkey; however, not for the domestic dog, Canis familiaris. Sertoli cells are the only readily accessible cell type in the body which expresses all six type IV collagens. These collagens play key roles in tissue structure, basement membrane formation, and filtration. The study of these genes is necessary to determine their exact roles and regulation in the aforementioned functions and to investigate diseases associated with mutations in these genes. For such studies, a cell culture system is a requisite tool. Therefore, Sertoli cells were targeted, and a culture was established from cells isolated from canine testes. Cultures maintained consistent morphology and steady growth for up to seven passages. Cultured cells were identified as Sertoli cells through positive Western blot results for SOX9 and Clusterin B proteins and transcript sequence verification of SOX9 as well as the presence of type IV collagen transcripts. Primary cultures of canine Sertoli cells will provide a useful tool for study of the function and regulation of collagen genes and will permit new research pertaining to canine health while also serving as a model for the study of human diseases. Keywords Canis familiaris * Sertoli cells * Primary cell culture * Type IV collagens

The type IV collagens are crucial structural components of basement membranes throughout the body and are critical for cell and tissue structure, as well as cell differentiation, growth, and adhesion (Aumailley and Gayraud 1998; Timpl 1989; Yurchenco et al. 2002). Despite the structural and functional importance of the encoded proteins, regulation of this gene family is incompletely understood. Sertoli cells provide an ideal cell system for the study of type IV collagens because these cells express all six of these collagens (Kahsai et al. 1997) and are readily available from testes of castrated animals, such as the dog. Primary Sertoli cell cultures have been established for several animals including the sheep and rhesus monkey, but not the dog (Majumdar et al. 1998; Merhi et al. 2001). The dog, however, is an excellent genetic model for study of human hereditary diseases as well as cellular and developmental biology. Work presented herein was done to isolate and culture canine Sertoli cells for a unique objective. Previous studies involving Sertoli cells have focused on their spermatogenic function and the genetic regulation of this function, whereas we propose to use this system as an in vitro model in which to study type IV collagens (Roberts et al. 1995; Majumdar et al. 1998; Merhi et al. 2001; Tabuchi et al. 2002).

Testicular tissue was obtained from seven mixed-breed dogs from a colony housed at Texas A&M University. One testicle was isolated from each dog, and the capsule, epididymus, and blood vessels were removed. The testicle was quartered and immediately placed in culture media consisting of Dulbecco’s modified Eagle’s media: nutrient mixture F12 (DMEM: F12, 1:1; Gibco, Grand Island, NY) plus 20% fetal bovine serum (FBS; Invitrogen, Carlsbad, CA) supplemented with 29 [mu]g/ml gentamicin (Gibco).

Tissue was minced and further digested at 37[degrees] C with 0.3 wv/ml Liberase Blendzyme 3 (Roche, Indianapolis, IN) and glass beads, while shaking gently. The supernatant, minus cell aggregates, was then collected and washed three times by centrifugation for 5 min at 1,500 rpm, and new culture media were added. Resuspended cells were then filtered through a 100-[mu]m filter to remove any cell aggregates. Finally, cells were cultured or frozen for later use.

Cells were cultured by seeding 100 x 15 mm treated dishes with subconfluent densities of cell suspensions and culture media. Cultures were incubated at 37[degrees] C in the presence of 5% CO2 and allowed to adhere overnight. After cells adhered, free-floating cells and debris were removed with the media, and new media were added. At 70-80% confluency, cells were subcultured in a 1:2 ratio by incubation with PBS for 15 min, followed by TrypLE Express stable trypsin replacement reagent (Gibco) for 10 min, both at 37[degrees] C.

Frozen stocks were also maintained for later use. Cells were removed from the culture dish as described above with TrypLE Express. Equal volumes of cell suspension and freezing media (DMEM: F12, gentamicin, 20% FBS, and 15% dimethyl sulfoxide) were added to a cryovial and slowly frozen in a Nalgene Cryo 1[degrees] C Freezing Container (Nalge Nunc International, Rochester, NY) at -80[degrees] C overnight then transferred to liquid nitrogen for long-term storage.

When needed, cryovials were thawed in a 37[degrees] C water bath, and the cell suspension was immediately added to 10 ml of culture media. The new suspension was centrifuged at 1,500 rpm for 5 min, followed by removal of the supernatant. The pellet containing cells was resuspended in fresh culture media and plated. These cultures were then maintained and split as described above.

Cultures produced a monolayer with a consistent morphology indicating a predominantly homogenous culture. This morphology was maintained throughout each passage and after thawing from frozen stocks (Fig. 1). Cultured cells sustained a steady growth curve for several passages, dividing to confluency for seven passages, at which point division decreased dramatically. Confluency was typically reached by 2 d for earlier passages but took as long as 10 d for later passages.

Cells were positively identified as Sertoli cells by Western blot and sequence analysis. Western blot analysis was performed for both SOX9 and Clusterin B as follows. Protein was extracted from cells subcultured once using the RIPA Lysis Buffer Kit (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) according to the manufacturer’s protocol. Seventy-six micrograms of total protein, quantified using the BCA Protein Assay Kit (Pierce, Rockford, IL) following manufacturer’s protocol, was boiled for 5 min along with 100 mM Tris, 25% Glycerol, 2% SDS, 0.01% Bromophenol Blue, and 10% Beta- Mercaptoethanol at pH 6.8, in a 1:2 ratio with the protein. This was then loaded onto a pre-cast Ready Gel 4-15% Tris-HC1 (BioRad Inc., Hercules, CA). Proteins were separated by electrophoresis at 200 V for 30-40 min and transferred to an Immuno-Blot PVDF membrane (0.2 [mu]m; BioRad) by electric current of 350 mA for 1 h at 4[degrees] C. Transfer of proteins was confirmed by staining with Ponceau S. The PVDF membrane with proteins bound was blocked for 2 h rocking gently at room temperature in 5% non-fat milk TBS solution. After blocking, the membrane was incubated in primary antibody at 4[degrees] C overnight. The two primary antibodies and their concentrations used were as follows: SOX9 (H-90) rabbit polyclonal antibody (Santa Cruz Biotechnology, catalog # sc-20095) at a 1:1,000 dilution and Clusterin B (C-18) goat polyclonal antibody (Santa Cruz Biotechnology, catalog # sc-6419) at a 1:1,000 dilution. Primary antibody was removed, and the membrane was washed in 3% milk TBS solution once, 0.025% Tween 20 (BioRad), 3% milk solution twice, and once in TBS alone. All washes were performed at room temperature gently rocking for 10 min each. The membrane was then incubated with secondary antibody for 1 h at room temperature, while gently rocking. Secondary antibodies used to detect SOX9 and Clusterin B were goat anti-rabbit IgG-HRP antibody (Santa Cruz Biotechnology, catalog # sc-2004) at a 1:20,000 dilution and donkey anti-goat IgG- HRP antibody (Santa Cruz Biotechnology, catalog # sc-2020) at a 1:40,000 dilution, respectively. The secondary antibody was removed, and the membrane was incubated with Immobilon Western Chemiluminescent HRP Substrate (Millipore Corporation, Billerica, MA) as per manufacturer’s protocol. Finally, an X-ray film was exposed to the membrane for 30 s and developed using a Mini-Medical X-ray film processor (AFP Imaging Corporation, Elmsford, NY). The results of this Western blot are shown in Fig. 2.

In testes, Sertoli cells are the only cell type that produces these proteins; therefore, positive staining for both proteins excluded other cell types that might have been isolated and con finned the presence of Sertoli cells. Note in Fig. 2 the unique staining pattern and size range for Clusterin B. This is due to the glycosylation of this protein. Staining for SOX9, however, produced a band twice the size expected for this protein, potentially indicative of the presence of a multimer.

To confirm that the band present was indeed a multimer, sequence verification was performed. To do so, total RNA was isolated using RNA STAT-60 (Iso-Tex Diagnostics, Inc., Friendswood, TX) according to the manufacturer’s protocol, and cDNA was made using the Sigma Enhanced Avian HS reverse transcriptase-polymerase chain reaction (PCR) kit (Sigma Aldrich, St. Louis, MO) following the manufacturer’s protocol. Amplification by PCR of cDNA was carried out with each 20-[mu]l reaction containing 1.2 mM of MgCl^sub 2^ 0.25 mM of each dNTP, 1.0 [mu]M of each primer (forward and reverse), 0.001 mg of bovine serum albumin (Promega, Madison, WI), 1 U of Taq DNA polymerase (Fisher Scientific, Pittsburgh, PA), and 2 [mu]l of IX Taq DNA polymerase buffer B (Fisher Scientific). Amplification hot-start cycling conditions were as follows: 94[degrees] C for 5 min, followed by 35 cycles of 94[degrees] C for 30 s, 55[degrees] C for 30 s, and 72[degrees] C for 30 s, then a single cycle at 72[degrees] C for 10 min. The polymerase plus half of the polymerase buffer and MgCl2 were added after the first 94[degrees] C cycle. Primers used for SOX9 were F: CAAGAAAGACCACCCGGAT TACAA and R: GGAGGAGGAGTGCGGCGAGT (product size 154 bases). Products were separated by gel electrophoresis and then visualized using ethidium bromide (Fig. 2c). Products of the correct size were cut out and purified using Qiaex(R) II Gel Extract Kit (Qiagen, Inc., Valencia, CA) following the manufacturer’s protocol. Excised DNA was then used for nucleotide sequencing using the Big Dye Terminator v 1.1 Cycle Sequencing Kit (Applied Biosystems) and resolved on an ABI 3730 Genetic Analyzer (Applied Biosystems). The resulting sequence was aligned correctly to the known SOX9 sequence (GenBank accession number AY237827) using Clustal W (http:// www.ebi.ac.uk/clustalw/). This verified the presence of the SOX9 transcript, thereby providing further evidence to support the hypothesis that the protein detected by Western blotting is indeed a SOX9 multimer. Cells were also tested for the presence of type IV collagen gene transcripts, along with beta-actin. Primer sequences were as follows: COL4A1 F: CCCCAAAGGA CAGCAAGGT, R: CACCGTCAAAACCAGGAATACC, COL4A2 F:TTGGCCTGGAAGGTTATCGT, R: TTCCCCTCATCTCCTTTGCTT, COL4A3 F:GAGCCT TATATTAGCAGATGCAC, R: TCAGTGGTTTGGCTGT GAATG, COL4A4 F: GGCTACAGTCTGTTATACCT GAAGGA, R: AAGACCCCTGCCAGACCAA, COL4A5 F: GAGCATGGAGCCCCTGAA, R: TCGTGTGCATCAT GAAGGAATAG, COL4A6 F: CCAGGACCTGGGT TTTGCT, R: AGTAGATGAAGGGCATGGTGCTA, and beta-actin F: TGCGTGACATTAAGGAGAAG, R: CTGCATCCTGTCGGCAATG. RNA was isolated from cells as described above, and cDNA was made according to the manufacturer’s instructions using the ABI High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). A total of 100 ng of cDNA was used in the subsequent reactions, and amplification of the type IV collagen gene transcripts was carried out as described above. Positive controls were also run for each reaction to ensure products obtained were of the correct size. Products were separated by gel electrophoresis and visualized by ethidium bromide (Fig. 3). Cells were found to express all six of the type IV collagen genes, again providing evidence to support the isolation of Sertoli cells.

Figure 1 shows the morphology of the isolated canine cells. In addition to the consistency of the morphology, the cells also show a strong similarity to the Sertoli cell lines previously published (Walther et al. 1997; Majumdar et al. 1998; Merhi et al. 2001). This similarity, along with the Western blot results, verified by sequence analysis when necessary, for proteins known to be produced in Sertoli cells, demonstrate the cells isolated and cultured were indeed Sertoli cells.

Primary culture of canine Sertoli cells will permit further study into the cellular functions and the regulation of type IV collagens. Because Sertoli cells are one of a select set of cell types that express all six genes in the type IV collagen family (alpha 1-6), and because these cell types are easily accessible, they are an ideal candidate for the study of the expression of these genes (Kahsai et al. 1997).

Received: 7 July 2007 /Accepted: 3 October 2007 /Published online: 1 November 2007 / Editor: J. Denry Sato

(c) The Society for In Vitro Biology 2007

References

Aumailley M, Gayraud B (1998) Structure and biological activity of the extracellular matrix. J Mol Med 76: 253-265

Kahsai TZ, Enders GC, Gunwar S, Brunmark C, Wieslander J, Kalluri R, Zhou J, Noelken ME, Hudson BG (1997) Seminiferous tubule basement membrane. Composition and organization of type IV collagen chains, and the linkage of alpha3(IV) and alpha5(IV) chains. J Biol Chem 272: 17023-17032

Majumdar SS. Winters SJ. Plant TM (1998) Procedures for the isolation and culture of Sertoli cells from the testes of infant, juvenile, and adult rhesus monkeys (Macaco mulatto). Biol Reprod 58: 633-640

Merhi RA, Guillaud L, Delouis C, Cotinot C (2001) Establishment and characterization of immortalized ovine Sertoli cell lines. In Vitro Cell Dev Biol Anim 37: 581-588

Roberts KP, Banerjee PP, Tindall JW. Zirkin BR (1995) Immortalization and characterization of a Sertoli cell line from the adult rat. Biol Reprod 53: 1446-1453

Tabuchi Y. Ohta S, Yanai N, Obinata M, Kondo T. Fuse H. Asano S (2002) Development of the conditionally immortalized testicular Sertoli cell line TTE3 expressing Sertoli cell specific genes from mice transgenic for temperature sensitive simian virus 40 large T antigen gene. J Urol 167: 1538-1545

Timpl R (1989) Structure and biological activity of basement membrane proteins. Eur J Biochem 180: 487-502

Walther N. Jansen M, Ergun S, Kascheike B, Tillmann G, Ivell R (1997) Sertoli cell-specific gene expression in conditionally immortalized cell lines. Adv Exp Med Biol 424: 139-142

Yurchenco PD, Smirnov S. Mathus T (2002) Analysis of basement membrane self-assembly and cellular interactions with native and recombinant glycoproteins. Methods Cell Biol 69: 111-144

A. G. Davidson * R. J. Bell * K. E. Murphy (*)

Department of Pathobiology, College of Veterinary Medicine

and Biomedical Sciences, Texas A&M University,

College Station, TX 77843-4467, USA

e-mail: kmurphy@cvm.tamu.edu

G. E. Lees

Department of Small Animal Clinical Sciences,

College of Veterinary Medicine and Biomedical Sciences,

Texas A&M University,

College Station, TX, USA

Copyright Society for In Vitro Biology Nov/Dec 2007

(c) 2007 In Vitro Cellular & Developmental Biology; Animal. Provided by ProQuest Information and Learning. All rights Reserved.