• E-mail
  • Print
  • Comment
  • Font Size
  • Digg
  • del.icio.us
  • Discuss article

Recruitment of Osteoclast Precursors By Stromal Cell Derived Factor- 1 (SDF-1) in Giant Cell Tumor of Bone

Posted on: Friday, 11 February 2005, 03:00 CST

Abstract

Giant cell tumor (GCT) of bone is a unique bone lesion that is characterized by an excessive number of multinucleated osteoclasts. GCT consists of neoplastic stromal cells, multinucleated osteoclasts and their precursors, thus serving as a naturally occurring human disease model for the study of osteoclastogenesis. It still remains unclear how stromal cells of GCT recruit osteoclast precursors. In the present study, we characterized the cellular components of GCT and confirmed the presence of CD14^sup +^-monocytes/CD68^sup +^- macrophages and CD34^sup -^-hematopoetic stem cells that express CXCR4, a specific receptor for SDF1; SDF-1 gene expression and presence of SDF-I protein were confirmed by real time RT-PCR, in situ hybridization, and immunohistochemistry in the GCT tissue and cultured cells. SDF-I was present at 25-50 ng/ml in the conditioned media from the GCT cultures, which is in the range of physiological chemotactic concentration. Migration of osteoclast precursors was 2.5-fold higher in response to GCT conditioned media compared to the control media; and migration was inhibited by an average of 36% with anti-SDF-1 neutralizing antibody or competing recombinant SDF-I. These results suggest that SDF-I is one of the significant chemoattractant factors involved in the recruitment of hematopoietic osteoclast precursor cells during tumor-induced osteoclastogenesis.

2004 Orthopaedic Research Society. Published by Elsevier Ltd. All rights reserved.

Keywords: SDF-1; Osteoclast; Giant cell tumor

Introduction

Understanding the molecular mechanisms of osteoclastogenesis is an important first step in determining therapeutic targets for pathologic osteolysis such as benign bone tumors and metastatic bone cancers. Osteoclasts are formed by the fusion of monocyte/ macrophage precursor cells via the activation of molecular pathways involving, among others, receptor activator of nuclear factor kappa B ligand (RANKL), macrophage colony stimulating factor (MCSF), osteoclast-associated receptor (OSCAR), tumor necrosis factor (TNF), and interleukins (IL) [9,17,19], Furthermore, the mechanism by which osteoclast precursor cells are recruited and stimulated by neoplastic stromal cells has recently drawn attention [20,31].

We have established several cell lines from benign osteolytic tumors, such as giant cell tumor (GCT), that demonstrate a very well denned area of severe bone destruction on radiographs. GCT are primary neoplasms of the skeleton [16] and cause extensive and destructive ostcolysis [11]. The histological makeup of giant cell tumors consists of three cell types: 1) mononuclear mesenchymal stromal cells, which represent the tumor (proliferating) component of GCT, 2) hematopoietic mononuclear osteoclast precursors, which resemble monocytes, and 3) multinucleated giant cells, which resemble osteoclasts [3,10,14].

Chemokines are chemoattractant cytokines that can attract inflammatory cells including osteoclast precursor cells [5,6,18]. We screened the chemokine gene expression in benign osteolytic bone tumors in order to identify the candidate molecules responsible for the recruitment of osteoclast precursors into the area of bone destruction by tumor osteoclasts. Among these chemokines CXCR4, unique receptor of SDF-I, is known to be expressed in monocytes and hematopoietic stem cells [2,6] that can serve as osteoclast precursor cells [27]. Since all of the benign osteolytic lesions consisted mainly of stromal cells, it would be quite valuable to determine the role of the SDF-I that these neoplastic stromal cells produce during osteoclastogenesis. The purpose of our study is to determine the chemoattractant role of the SDF-1/CXCR4 axis activation during recruitment of osteoclast precursors by neoplastic cells of GCT.

Materials and methods

After obtaining Internal Review Board approval, we examined nine GCT tissue samples and four GCT cell cultures for the presence of SDF-1 gene expression and protein, as well as their chemotactic effect on monocytes that can serve as osteoclast precursors. The diagnoses of GCT were established by biopsy prior to surgical excision. Tissues were obtained at the time of surgery from patients undergoing tumor resection. Human peripheral blood from healthy volunteers (Manhattan Blood Bank, New York) served as a source for the isolation of monocytes.

GCT culture

Fresh specimens were minced with scissors in Dulbecco's minimum essential medium (DMEM), producing a cell suspension with small fragments of tissue. The suspension was pelleted by centrifugation, and the small fragments were enzymatically digested in phosphate buffered saline (PBS) containing 1 mg/ml collagenase, 0.15mg/ml DNAse, and 0.15mg/ml hyaluronidase for 1h at 37C. The suspension was passed through sterile gauze to remove any undigested fragments, and the cells were either frozen in liquid nitrogen or seeded with DMEM supplemented with 10% fetal calf serum, 100U/ml penicillin, 100ng/ ml streptomycin, and 0.1% Fungizone (Ampholericin B). Cells were grown at 37C in a humidified atmosphere of 5% CO2 and 95% air. Culture medium was changed every 3-4 days. One of the remarkable features of these cells was their stable growth and morphology over passages. We used conditioned media collected from cell cultures in the 6-well plate 3 days after plating 2 10^sup 5^ cells per well. The generation of the cells were 5-10 passages. Among these four cell cultures, two cultures showed slromal cells to be the dominant cell (greater than 90% of the cell population) while the remaining two cultures consisted of about 10% stromal cells and 30% mononuclear cells and newly forming multinucleated cells. These observations on the cultures' cellular composition were consistent until we collected the conditioned media.

Immunohislochemical characterization of GCT tissue and culture

GCT tissues and cell culture were stained with antibodies specific to CD3, CD4, CD14, CD20, CD34, CD45, CXCR4 and SDF-1 (R&D, Minneapolis, MN). OCT compound embedded thin sections from nine different tissues and cover slips with four different GCT cultured cells were processed. Primary antibodies were not added in the negative controls. Secondary antibodies were added at room temperature. Diaminobenzidine was used for colorimetric detection. Synovial tissues from patients with rheumatoid arthritis were used for the positive controls. Both positive and negative controls demonstrated consistent results.

Real time RT-PCR

Total RNA from the tumor tissue and cultured cells was extracted using an RNeasy Mini Kit (Qiagen, Valencia, CA), according to the manufacturer's instructions. First-stranded cDNA was synthesized from 1 g of total RNA using a Superscript (Invitrogen, Carlsbad, CA) first-strand synthesis system for RT-PCR. The primers used for real time PCR of SDF-1 were sense 5'-aacgccaagglcgtggtcgt-3' and antisense 5'-tttggctgttgtgcttacttgtt-3' for SDF-1. GAPDH was used as internal control, with primer sequences of sense 5'cgctctctgctcctcctgttcg-3' and antisense 5'-ccgttctcagccttgacggtgc- 3'. The annealing temperatures for SDF-1 and GAPDH were 63C and 62C, respectively. The sizes of the bands were confirmed with a 100bp DNA ladder on 1.2% agarose gel. The relative gene expression was adjusted by the expression of GAPDH.

In situ hybridization of SDF-1 mRNA

Five micrometer-thin paraffin embedded sections were used for hybridization with 348 base-pair SDF-1 mRNA riboprobe

gggctcgtgccctgcatccctctcctcccagggcctgccccacagctcgggccctctgtgagatccgt ccagccgggaagagggtgattgctggggctcgtgccctgcatccctctcctcccaggg) labeled with digoxigenin. Sense and antisense single-stranded RNA probes were diluted with hybridization solution containing 50% formamide, 10mM Tris-HCl, 200ng/ml tRNA, 1 Denhardt solution, 10% dextran sulfate, 600mM NaCl, 0.25% SDS and ImM SDTA, and then incubated at 85C for 10min as previously described [22].

Hybridization was performed in a moist chamber at 50C for 16h. All of the hybridization procedures were carried out in an RNase- free environment. Washing was done with different types of solutions containing 5 SSC, 2 SSC, TNE (10 mM Tris-HCl, 500mM NaCl and 1 mM EDTA), and 0.2 SSC. Localization of cellular mRNA for SDF-1 was performed by immuno-color-detection. Anti-digoxigenin antibody in buffer solution (Roche-Boeringher Manheim, Indianapolis, IN) was added and incubated at room temperature for 30min. 5Bromo-4-chloro- 3-indolyphosphate and nitro blue tetrazolium were added and incubated for 4 h for colorimetric detection. Pathologic specimens containing symovial tissues of rheumatoid arthritis that were known to express SDF-1 mRNA served as a positive control. In the negative control, a sense riboprobe was used. Positive and negative results were consistent. Purple color indicated the expression of mRNA for SDF-1. Counterstaining was done with Safranin O as needed.

Quantification of human SDF-I by ELIS A

Colorimetric sandwich ELISA for human SDF-Iα was performed for cultured media with a Quantikine assay (R & D Systems, Minneapolis, MN), follow\ing the manufacturer's directions. The amount of SDF-I in the conditioned media was measured with reference to the standard SDF-I concentrations and the measurement was repeated twice. A monoclonal antibody specific for SDF-1 α has been precoated onto a microplate. Standards and conditioned media from GCT cell cultures were pipetted into the wells and any SDF- Iα is bound by the immobilized antibody. After washing away any unbound substance, an enzyme-linked polyclonoal antibody specific for SDF-Iα is added to the wells. Following a wash to remove any unbound antibody-enzyme reagent, a substrate solution is added to the wells and color develops in proportion to the amount of SDF- Ia bound in the initial step. The intensity of color is measured.

A standard dose-color intensity curve is generated by adding recombinant SDF-I and heat-inactivated fetal calf serum in various dilutions. The concentrations of SDF-I were Ong/ml, 0.25ng/ml, 0.5ng/ ml, Ing/ml, 10ng/ml, 50ng/ml and 100ng/ml.

One hundred microliters of standard SDF-I or conditioned media were added per well and incubated for 2 h at room temperature on a horizontal orbital microplate shaker set at 500 rpm and 0.12'' orbit. Each was washed four times by filling each well with 400 &953; of wash buffer. Two hundred microliters of SDF-Iα conjugate was added to each well and incubated for 2 h at room temperature on the shaker. Two hundred microliters of substrate solution were added to each well and incubated for 30 min at room temperature on the bench top while the wells were protected from the light. Fifty microliters of stop solution were added to each well and optical density was measured using a microreader set at 450nm. In order to correct the optical imperfections in the plate, the measurement was repeated at 540 nm. The readings at 540nm were subtracted from the readings at 450nm. The SDF-I in the conditioned media was quantitated by plotting the optical density on the SDF-I dose-optical density standard curve.

Cell migration assay

Cell harvesting: Monocytes from healthy donors were harvested as described previously [23]. Peripheral blood mononuclear cells (PBMC) were isolated from heparinized blood of healthy adult volunteers by density gradient centrifugation with Ficoll-Paque. The cells were washed twice in phosphate-buffered saline (PBS) and were resuspended in medium RPMI 1640 supplemented with 2mM glutamine and 10% fetal calf serum. Finally, cells were added to 96-well microtiter plates at a density of 2 10^sup 5^ cells per well. After incubation at 37C for 1 h, the non-adherent cells were removed by repeated vigorous washings. Human monocytes cells were incubated 18h prior to assay in serum free DMEM medium. Cells were inspected for round healthy morphology. The adherent cells were detached with 2mM EDTA/ 0.05% trypsin in Hanks Balanced Salt Solution containing 25mM HEPES per 100mm dish, incubated at 37C for 10 min, and were made to give l.0 10^sup 6^ cells per ml.

Addition of conditioned media, recombinant SDF-I and SDF-I neutralizing antibody: The QCM Chemotaxis 5 m cell migration assay system (Chemicon, Temecula, CA) was used. This system contained an upper cell migration plate and bottom feeder tray, each with 96- wells. The membrane at the bottom of the upper chamber has 5m pores through which monocytes can migrate in response to chemoattractants. The migrated colls are lysed, and their nucleic acids are fiuorcsccntly labeled with CyQuant dye and subsequently quantified with the use of a fluorescence reader.

Hundred microliter of conditioned media was added to the bottom wells of the feeder tray. No additional concentrating process was performed since the amount of SDF-I in the conditioned media was within the range of known chemotactic function. After gently resuspending the cells in 100 l of DMEM media containing 10% heat- denatured FBS, 1 10^sup 5^ cells were added into the top (migration) chamber. The conditioned media samples were then placed in the lower plates to induce cell migration. In order to block the SDF-I mediated cell migration, anti-SDF-1 antibody was added at a concentration of 50ng/ml into the migration chamber. In other wells, recombinant human SDF-I (rhSDF-I) (BD Bioscieiice, PaIo Alto, CA) was added to the upper chamber with monocytes in order to block the CXCR4 receptor on the monocytes.

The cells were incubated for 24 h at 37C in a CO2 incubator (5% CO2). The upper migration tray was then removed, and the cells and media were gently discarded. The migration tray was then placed onto the new unused 96-well feeder tray containing 1501 of prewarmed cell detachment solution in the wells, and then incubated for 30 min at 37C. Cells were completely dislodged from the underside by gently tilting the migration chamber plate back and forth several times during incubation. From the migration feeder tray, we transferred 75 l of the 150 l medium solution (cells that migrated through the membrane and detached from the membrane by detachment buffer) to a new 96-well plate. 150l of the mixture was transferred to a new 96- well plate for fluorescent measurement using 480/520nm filter set.

Calculation of results: A cell number-fluorescence uptake standard curve (cell-dose) was plotted for quantifications of the number of monocytes. This curve was generated by using blank media containing detachment buffer, lysis buffer and increasing numbers of monocytes. Migratory cell numbers were then determined using the cell-dose curve.

In vitro osteoclastogenesis

In order to determine whether rhSDF-1 enhances osteoclastogenesis in the presence of RANKL and to determine whether rhSDF-1 can substitute RANKL, we conducted in vitro osteoclastogenesis using RAW264.7 (American Type Culture Collection, Manassas, VA) cells that are known to form osteoclasts in response to RANKL. We added 25ng/ ml, 50ng/ml and 100ng/ml of rhSDF-1 to RAW264.7 cells in the presence or absence of 25nM, 5OnM and 5OnM of RANKL (R&D Systems, Minneapolis, MN). We measured tartrate resistant acid phosphalase (TRAP) activity by ELISA (R&D Systems, Minneapolis, MN) as described above after treating cells with rhSDF-1 or RANKL for 3 days.

Results

The presence of hamatopoietic stem cells and monocytes in GCT culture

We characterized the cellular components of GCT by immunostaining with CD3 (T-cell), CD4 (T-cell), CD 14 (monocytes), CD20 (B-cell), CD34 (hematopoietic stem cells), CD45 (monocyte/macrophage lineage) and CD68 (a histiocyte marker). The predominant cellular components were monocytes/macrophagcs that positively stained with CD14, CD45, and CD68. The CD14+ and CD68+ monocytes were distributed around blood vessels as well as within the tumor stroma, suggesting possible transendothelial migration from the peripheral circulation (Fig. IA). Multinucleated giant cells did not stain with the CD68 antibody. CD34+ cells were scattered in the GCT stroma.

The presence of SDF-I gene expression and protein in GCT

(1) Immunohistochemistry of GCT tissue using SDF-I and CXCR4 antibody. Fresh GCT tissues were embedded in an OCT block and 5m thin sections were prepared. The SDF-I protein was stained with the monoclonal antibody specific against SDF-Ia. SDF-1 was present throughout the tissue and was localized in the stromal cells of GCT (Fig. IB). CXCR4 positive macrophages and osteoclasts were present in the GCT tissue (Fig. 1C).

Fig. 1. Immunohistochemical localization SDF-1, CD14, and CXCR4 in GCT tissue. Brown color indicates positive staining. (A) CD14+ cells were present both around the blood vessel (V) and in the tumor stroma (x200; Hematoxyline). (B) SDF-1 is localized in the stromal cells of GCT around the blood vessel (V) (x200; Hematoxyline). (C) CXCR4-positive macrophages and multinucleated cells were scattered throughout the GCT stroma (x100; Hematoxyline).

(2) In situ hybridization. The SDF-1 gene expression was further confirmed by in situ hybridization. The mRNA for SDF-Ia was localized in the cytoplasm of stromal cells of GCT, but was not detected in giant cells and round cells (Fig. 2A). The SDF-1 gene expression was present in the stromal cells around the blood vessels as well as in the tumor stroma (Fig. 2B).

(3) RT-PCR. The expression of SDF-1 gene was analyzed by RT-PCR of RNA extracted from the GCT tissues and cultured cells. The amplified gene transcripts of 300 bp were identified as SDF-1 cDNA and compared to the GAPDH cDNA (Fig. 3). The SDF-1 mRNA was analyzed quantitatively by real time RT-PCR and compared to GAPDH cDNA. The expression was examined for nine GCT tissues and four GCT cultured cell lines. The expression level of SDF-I gene did not vary greatly among the GCT tissues and among the GCT cultures.

(4) The presence of SDF-1 in conditioned media of GCT cultures. Conditioned media samples from GCT culture were collected for in vitro osteoclastogenesis study. SDF-1 protein was measured in the conditioned media by the enzyme linked immuno-sorbent test (ELISA). The concentration of SDF-I was measured from conditioned media at various numbers of passages. Consistent with the cells' stable morphology and phenotypes, the concentration of SDF-I was quite consistent among different cell lines. As calculated against the reference concentration of recombinant SDF-I protein, SDF-I was present in the range of 25-50 ng/ml in the culture media of GCT cells.

Fig. 2. In situ hybridization of GCT tissue using a SDF-1 riboprobe. (A) SDF-1 mRNA (arrows; purple color) was expressed by stromal cells of GCT and not by multinucleated tumor osteoclasts (OC) (x200; Counterstaining with Safranin O). (B) The GCT stromal cells around the blood vessel (V) demonstrate expression of mRNA for SDF-I (arrows; x200, Counterstaining with Safranin O).

SDF-1 in GCT conditioned media induces monocyte chemotaxis

The in vitro migration assay was performed to test the chemotactic activity of SDF-1 produced by the GCT cel\ls. The conditioned media samples were used as the source of SDF-1. The migration of human peripheral blood monocytes was measured by the QCM Chemotaxis Assay System (Chemicon, CA). As the control, the conditioned media of normal stromal cells was used. Comparable migration was observed for the conditioned media of GCT and normal stromal cells. However, the anti-SDF-1 neutralizing antibody inhibited monocyte migration from 27% to 44% in four different conditioned media from GCT while the control media demonstrated neither migration nor inhibition. When the neutralizing SDF-1 protein was added to the monocytes in the upper chamber, similar degrees of migration inhibition were observed, thus confirming that the SDF-1-induced monocyte migration contributes significantly in the GCT-conditioned media. These results are summarized in Fig. 4.

Fig. 3. SDF-1 mRNA is present both in GCT tissue and cultured cells. Real-time RT-PCR was performed using RNAs isolated from the GCT tissue (T) and cultured cells (C). The 300 bp products of SDF-1 cDNA were present.

Fig. 4. Chemoattractive function of SDF-1 in the GCT conditioned media (N = 4) during migration of CD14(+) osleoclast precursors. GCT conditioned media induced 2.5-fold increase in monocyte migration when compared to the heat-inactivated control media. Chemotaxis was inhibited by a neutralizing SDF-I antibody in the conditioned media or by a competing recombinant human SDF-I (rhSDF-1) in the wells containing monocytes. The inhibitory effect was 36% of the chemotactic effect of the GCT conditioned media after adding either neutralizing SDF-I antibody or competing rhSDF-1. Photomicrographs above the bar graphs demonstrate migrating monocytes in response to media. GCT conditioned media demonstrates the largest number of migrating monocytes (arrows) in comparison to other groups.

(5) The role of rhSDF-1 in osteoclastogenesis. There was no statistical difference in TRAP activity between rhSDF-1 treated and non-treated groups in the presence of RANKL in RAW264.7 culture. rhSDF-1 did not demonstrate increase in TRAP activity without RANKL in RAW264.7 culture.

Discussion

Our data suggest that SDF-1 contributes to the recruitment of mononuclear precursor cells for osteoclastogenesis in the GCT. The SDF-I chemokine is unique in that it interacts with the specific receptor CXCR4 [7,24]. The CXCR4-expressing monocytes [2,6], such as CD14^sup +^- and CD68^sup +^-cells, were predominant cellular components in the GCT tissue. They were found specifically around blood vessels and within the tumor stroma, suggesting possible transendothelial migration from the peripheral circulation (Fig. 5). These results were consistent with the report by Blades et al. that SDF-1 and CXCR4 were involved in the process of extravasation of CD68^sup +^-monocytes/macrophages from the circulation into the synovium [6]. Gonzola et al. showed that the SDF-1/CXCR4 axis is critical in mediating lung inflammation [15]. Following attraction of precursors by the SDF-1/CXCR4 interaction, subsequent induction of matrix metalloproteinase-9 by SDF-I was suggested to facilitate transmigration through the endothelial cell layer of blood vessels and homing in bones [30].

Monocyte migration induced by the GCT conditioned media was inhibited up to 40% with both the anti-SDF-1 antibody and competing recombinant SDF-I protein. Thus, among the chemokines that could be involved, SDF-1 appears to be a significant inducer of the monocyte migration promoted by the GCT conditioned media. Although these data were obtained in vitro in this study, Blades et al. showed in vivo that the SDF-1/CXCR4 axis mediated the migration of CD68^sup +^ monocytes from the circulation [6]. Yu et al. reported that SDF-1 is a key signal for the selective attraction of circulating osteoclast precursors into bone and marrow sites through CXCR4-mediated targeting [30], thus supporting our results. Higher induction of migration was consistently observed with the conditioned media of different GCT cultures as compared to the conditioned media with the normal stromal cells [8]. The conditioned media with bone marrow stromal cells showed a highly efficacious lymphocyte chemotactic activity which was attributed to SDF-I and was 10 times more potent than any chemoattractants known [8]. Since the SDF-!-induced migration was more significant with the GCT-conditioned media than the normal bone marrow stromal cell (American Type Culture Collection, Manassas, VA)-conditioned media in our study (data not shown), the GCT stromal cells could have a preferential expression of SDF-I, recruiting OC precursors and hematopoietic stem cells. The GCT cultures we established from the GCT tissues resected from patients are unique in that three types of cell populations (including stromal cells, hematopoietic monocytes, and multinucleated giant cells) are maintained through many passages in an autocrine manner, without exogenous supplements of osteoclast differentiation factors such as M-CSF and RANKL. SDF-I is instrumental in mobilizing hematopoietic stem cells from the bone marrow [2].

Fig. 5. A schematic diagram illustrating a chemotactic role of SDF-1 in GCT stromal cell induced osteoclastogenesis. GCT stromal cells secrete SDF-1 and other chemokines to recruit tumor osteoclast precursors that have specific receptors (CXCR4) for SDF-I from the vessels. Recruited precursor cells fuse to form multi-nucleated tumor osteoclasts in response to RANK/RANKL axis activation or other osteoclastogenic stimuli.

A variety of chemokines are shown to be involved in recruitment of monocytes [4,20,25]. MCP-I, MIP-I, IL-I, IL-8, TNFα and other chemokines are shown to be released from breast cancer, prostate cancer, myeloma, and GCT cells, and are responsible for recruitment and fusion of monocytes [1,12,13,26]. Zheng et al. have suggested the recruitment of CD68+-macrophages is due to the TGF- β 1-regulated production of MCP-I by the GCT stromal cells [31]. MCP-I expression was confirmed in our GCT tissues and cultures, but it was significantly reduced in GCT cultures compared to GCT tissues. Therefore, as has been reported, MCP-I expression by stromal cells may be regulated by growth factors and cytokines in vivo. SDF-I was more potent than TNFa in promoting the migration of pro-myelomonocytes [6]. Osteoclast formation from monocytes was efficient in the GCT conditioned media alone (unpublished observation). These results suggest that the GCT stromal cells produce a variety of factors which coordinately orchestrate the recruitment of OC precursors and their differentiation. The constitutively high expression of SDF-I by GCT stromal cells may initiate this orchestrated production of multinucleated giant cells by recruiting OC precursors and hematopoietic stem cells.

The role of SDF-I in proliferation and cell and survival is becoming clearer [28,29]. There are an increasing number of reports suggesting that SDF-I also protects cells from spontaneous apoptosis [21]. One of the intriguing aspects of our culture systems is that multinucleated giant cells are maintained after many passages along with mononuclear cells and proliferating stromal cells. In addition to the function of SDF-I in the process of recruitment of osteoclast precursors and hematopoietic stem cells, SDF-I may play a direct role in conferring their prolonged survival and promoting their proliferation and differentiation in cooperation with osteoclastogenic factors. In conclusion, SDF-I plays a chemoattractant role during tumor-induced osteoclastogenesis. Further studies would be necessary to define the role of SDF-I in cell survival and possible osteoclastogenesis in lieu of macrophage colony stimulating factor.

Acknowledgement

The study was supported by NIH T32 Training Grant (T.S.L. and M.B.Y.), Woman-at-Risk (F.Y.L.) and Orthopaedic Research and Education Foundation (F.Y.L.).

References

[1] Abe M, Hiura K, Wilde J, Moriyama K, Hashimoto T, Ozaki S, et al. Role for macrophage inflammatory protein (MIP)-1alpha and MIP- 1beta in the development of osteolytic lesions in multiple myeloma. Blood 2002; 100:2195-202.

[2] Aiuti A, Webb IJ, Bleul C, Springer T, Gulierrez-Ramos JC. The chemokine SDF-I is a chemoattractant for human CD34+ hemalopoietic progenitor cells and provides a new mechanism to explain the mobilization of CD34+ progenitors to peripheral blood. J Exp Med 1997; 185:111-20.

[3] Athanasou NA, Bliss E, Gatter KC, Heryet A, Woods CG, McGee JO. An immunohistological study of giant-cell tumour of bone: evidence for an osteoclast origin of the giant cells. J Pathol 1985;147:153-8.

[4] Atkins GJ, Haynes DR, Geary SM, Loric M, Crotti TN, Findlay DM. Coordinated cytokine expression by stromal and hematopoietic cells during human osteoclast formation. Bone 2000;26: 653-61.

[5] Baggiolini M. Chemokines in pathology and medicine. J Int Med 2001;250:91-104.

[6] Blades MC, Ingegnoli F, Wheller SK, Manzo A, Wahid S, Panayi GS, et al. Stromal cell-derived factor l (CXCL12) induces monocyte migration into human synovium transplanted onto SCID Mice. Arthritis Rheum 2002;46:824-36.

[7] Bleul CC, Farzan M, Choe H, Parolin C, dark-Lewis I, Sodroski J, et al. The lymphocyte chemoattractant SDF-I is a ligand for LESTR/ fusin and blocks HIV-I entry. Nature 1996;382: 829-33.

[8] Bleul CC, Fuhlbrigge RC, Casasnovas JM, Aiuti A, Springer TA. A highly efficacious lymphocyte chemoattractant, stromal cellderived factor 1 (SDF-I). J Exp Med 1996;184:1101-9.

[9] Boyle WJ, Simonet WS, Lacey DL. Osteoclast differentiation and activation. Nature 2003;423:337-42.

[10] Burmester GR, Winchester RJ, Dimitriu-Bona A, Klein M, Steiner G, Sissons HA. Delineation of four cell types comprising the giant cell tumor of bone. Expression of Ia and monocyte-macrophage lineage antigens. J Clin Invest 1983;71: 1633-48.

[11] Campanacci M, Baldini N, Boriani S, Sudanese A. Giant-cell tumor of bone. J Bone Joint Sur\g Am 1987;69:106-14.

[12] Choi SJ, Cruz JC, Craig F, Chung H, Devlin RD, Roodman GD, et al. Macrophage inflammatory protein 1-alpha is a potential osteoclast stimulatory factor in multiple myeloma. Blood 2000;96: 671-5.

[13] Choi SJ, Oba Y, Gazitt Y, Alsina M, Cruz J, Anderson J, et al. Antisense inhibition of macrophage inflammatory protein 1-alpha blocks bone destruction in a model of myeloma bone disease. J Clin Invest 2001;108:1833-41.

[14] Goldring SR, Roelke MS, Petrison KK, Bhan AK. Human giant cell tumors of bone identification and characterization of cell types. J CHn Invest 1987;79:483-91.

[15] Gonzalo JA, Lloyd CM, Peled A, Delaney T, Coyle AJ, Gutierrez-Ramos JC. Critical involvement of the chemotactic axis CXCR4/ stromal cell-derived factor-1 alpha in the inflammatory component of allergic airway disease. J Immunol 2000; 165:499-508.

[16] Hasegawa T, Hirose T, Seki K, Sano T, Hizawa K. Transforming growth factor alpha and CD68 immunoreactivity in giant cell tumours of bone: a study on the nature of stromal and giant cells, and their interrelations. J Pathol 1993; 170:305-10.

[17] Hofbauer LC, Heufelder AE. The role of osteoprotegerin and receptor activator of nuclear factor kappa B ligand in the pathogenesis and treatment of rheumatoid arthritis. Arthritis Rheum 2001;44:253 9.

[18] Horuk R. Chemokine receptors. Cytokine Growth Factor Rev 2001;12:313-35.

[19] Kirn N, Takami M, Rho J, Josien R, Choi Y. A novel member of the leukocyte receptor complex regulates osteoclast differentiation. J Exp Med 2002;195:201-9.

[20] Kukita T, Nomiyama H, Ohmoto Y, Kukita A, Shuto T, hotokebuchi T, et al. Macrophage inflammatory protein-1 alpha (LD78) expressed in human bone marrow: its role in regulation of hematopoiesis and osteoclast recruitment. Lab Invest 1997;76: 399- 406.

[21] Lataillade JJ, clay D, Bourin P, Herodin F, Dupuy C, Jasmin C, el al. Stromal cell-derived factor 1 regulates primitive hematopoiesis by suppressing apoptosis and by promoting G(0)/G(1) transition in CD34(+) cells: evidence for an aulocrine/paracrine mechanism. Blood 2002;99:1117-29.

[22] Lee FY, Choi YW, Behrens FF, DeFouw DO, Einhorn TA. Programmed removal of chondrocytes during endochondral fracture healing. J Orthop Res 1998;16:144-50.

[23] Most J, Spoil L, Mayr G, Gasser A, Sard A, Dierich MP. Formation of multinucleated giant cells in vitro is dependent on the stage of monocyte to macrophage maturation. Blood 1997;89: 662-71.

[24] Oberlin E, Amara A, Bachelerie F, Bessia C, Virelizier JL, Arenzana-Seisdedos F, et al. The CXC chemokine SDF-I is the ligand for LESTR/fusin and prevents infection by T-cell-line-adapted HIV- I. Nature 1996;382:833-5.

[25] Ohsaki Y, Takahashi S, Scarcez T, Demuldcr A, Nishihara T, Williams R, et al. Evidence for an aulocrine/paracrine role for interleukin-6 in bone resorption by giant cells from giant cell tumors of bone. Endocrinology 1992; 131:2229-34.

[26] Sabokbar A, Kudo O, Athanasou NA. Two distinct cellular mechanisms of osteoclast formation and bone resorption in periprosthetic osteolysis. J Orthop Res 2003;21:73-80.

[27] Shalhoub V, Elliott G, Chiu L, Manoukian R, Kelley M, Hawkins N, et al. Characterization of osteoclast precursors in human blood. Br J Haematol 2000;111:501 12.

[28] Suzuki Y, Rahman M, Mitsuya H. Diverse transcriptional response of CD4(+) T cells to stromal cell-derived factor (SDF)1: cell survival promotion and priming effects of SDF-I on CD4(+) T cells. J Immunol 2001;167:3064-73.

[29] Tilton B, Ho L, Oberlin E, Loetscher P, Baleux F, dark- Lewis I, et al. Signal transduction by CXC chemokine receptor 4. Stromal cell-derived factor 1 stimulates prolonged protein kinase B and extracellular signal-regulated kinase 2 activation in T lymphocytes. J Exp Med 2000;192:313-24.

[30] Yu X, Huang Y, Collin-Osdoby P, Osdoby P. Stromal cell- derived factor-1 (SDF-I) recruits osteoclast precursors by inducing chemotaxis, matrix metalloproteinase-9 (MMP-9) activity, and collagen transmigration. J Bone Miner Res 2003;18:1404 18.

[31] Zheng MH, Fan Y, Smith A, Wysocki S, Papadimitriou JM, Wood DJ. Gene expression of monocyte chemoattractant protein1 in giant cell tumors of bone osteoclastoma: possible involvement in CD68+ macrophage-like cell migration. J Cell Biochem 1998;70:121-9.

Ted S. Liao a,1 Matthew B. Yurgehm a,1 Seong-Sil Chang a, Hui- Zhu Zhang b, Koko Murakami a, Theodore A. Blaine a, May V. Parisien c, William Kim d, Robert J. Winchester b,c, Francis Young-In Lee a'*

a Center for Orthopaedic Research, Department of Orthopaedic Surgery, Columbia University, 622 W. 168th Street, BHN816, New York, NY 10032, USA

b Institute of Autoimmune and Molecular Disease, Department of Pediatrics, Columbia University, 622 W. 168th Street, New York, BHN816, New York, NY 10032, USA

c Department of Pathology, Columbia University, 622 W. 168th Street, BHN816, New York, NY 10032, USA

d Department of Surgery, Columbia University, 622 W. 168th Street, BHN816, New York, NY 10032, USA

Received 20 January 2004; accepted 11 June 2004

* Corresponding author. Tel.: +1 212 305 3293; fax: +1 212 305 8271.

E-mail address: fll27@columbia.edu (F.Y.-I. Lee).

1 T.S.L. and M.B.Y. equally contributed to the work.

Copyright Journal of Bone and Joint Surgery, Inc. Jan 2005


Source: Journal of Orthopaedic Research

More News in this Category


Related Articles



Rate this article:
1/52/53/54/55/5

User Comments (0)

Comment on this article

Your Name
Text from the image
Comment
max 1200 chars
* All fields are required

redOrbit Friends