Quantcast
  • E-mail
  • Print
  • Comment
  • Font Size
  • Digg
  • del.icio.us
  • Discuss article

Differences in Intensity and Specificity of Hypersensitive Response Induction in Nicotiana Spp. By INF1, INF2A, and INF2B of Phytophthora Infestans

Posted on: Tuesday, 8 March 2005, 03:00 CST

Elicitins form a family of structurally related proteins that induce the hypersensitive response (HR) in plants, particularly Nicotiana spp. The elicitin family is composed of several classes. Most species of the plant-pathogenic oomycete genus Phytophthora produce the well-characterized 10-kDa canonical elicitins (class I), such as INF1 of the potato and tomato pathogen Phytophthora infestans. Two genes, inf2A and inf2B, encoding a distinct class (class III) of elicitin-like proteins, also occur in P. infestans. Unlike secreted class I elicitins, class III elicitins are thought to be cell-surface-anchored polypeptides. Molecular characterization of the inf2 genes indicated that they are widespread in Phytophthora spp. and occur as a small gene family. In addition, Southern blot and Northern blot hybridizations using gene-specific probes showed that inf2A and inf2B genes and transcripts can be detected in 17 different P. infestans isolates. Functional secreted expression in plant cells of the elicitin domain of the inf1 and inf2 genes was conducted using a binary Potato virus X (PVX) vector (agroinfection) and Agrobacterium tumefaciens transient transformation assays (agroinfiltration), and resulted in HR-like necrotic symptoms and induction of defense response genes in tobacco. However, comparative analyses of elicitor activity of INF1, INF2A, and INF2B revealed significant differences in intensity, specificity, and consistency of HR induction. Whereas INF1 induced the HR in Nicotiana benthamiana, INF2A induced weak symptoms and INF2B induced no symptoms on this plant. Nonetheless, similar to INF1, HR induction by INF2A in N. benthamiana required the ubiquitin ligase-associated protein SGT1. Overall, these results suggest that variation in the resistance of Nicotiana spp. to P. infestans is shadowed by variation in the response to INF elicitins. The ability of tobacco, but not N. benthamiana, to respond to INF2B could explain differences in resistance to P. infestans observed for these two species.

Specific recognition events are well established as the functional basis of numerous incompatible (resistance) interactions between plants and pathogens, particularly those occurring at the subspecific or varietal level (race- or cultivar-specific resistance). Recognition is defined by the direct or indirect perception of pathogen signal molecules by plant receptors (Dangl and Jones 2001; Staskawicz et al. 1995). The pathogen signal molecules commonly are referred to as elicitors, encoded by avirulence (Avr) genes, whereas the plant receptors are the resistance proteins encoded by R genes. Recognition results in the induction of signal transduction pathways leading to the expression of complex defense responses, including the hypersensitive response (HR), a form of programmed cell death often associated with disease resistance in plants (Dangl et al. 1996). Numerous examples of race- or cultivar-specific interactions follow the Avr-R gene model; however, the extent to which recognition events are involved in incompatible interactions occurring at the species or genus level (nonhost resistance) remains unclear (Heath 2000; Kamoun 2001; Kamoun et al. 1999c).

The oomycete plant pathogen Phytophihom infestans causes late blight, a devastating and re-emerging disease of potato and tomato (Birch and Whisson 2001; Fry and Goodwill 1997a,b; Schiermeier 2001; Shattock 2002; Smart and Fry 2001). In contrast to host plants, nonhosts, such as tobacco and other species of the genus Nicotiana, typically are resistant to P. infestans. Cytological analyses of leaves of several Nicotiana spp. inoculated with P. infestans showed that penetration of epidermal cells always occurred (Kamoun et al. 1998e). This was followed by the HR that varied between different Nicotiana spp. in timing, severity, and number of affected cells. In Nicotiana tabacum (tobacco), P. infestans was blocked early in the infection following penetration of epidermal cells, and secondary intercellular hyphae were not observed. In contrast, in N. benthamiana, secondary hyphae with haustoria were formed and some level of mesophyll colonization occurred. The plant response reached a climax 3 days post inoculation with clusters of HR cells engulfing the invading hyphae. These observations suggest that several layers of resistance to P. infestans occur with various degrees of effectiveness in the different Nicotiana species (Kamoun 2001; Kamoun et al. 1998b; Kamoun et al. 1999c).

P. infestans and other Phytophthora spp. express a family of structurally related extracellular proteins, known as elicitins, which induce the HR and other biochemical changes associated with defense responses in Nicotiana spp. but not in potato and tomato (Kamoun et al. 1993, 1997a; Ponchet et al. 1999; Ricci et al. 1989; Sasabe et al. 2000). P. infestans strains deficient in the elicitin INFl induced disease lesions in N. bentharniana, suggesting that INFl conditions resistance in this species (Kamoun et al. 1998b). In contrast, INF1-deficient strains remained unable to infect other Nicotiana spp., such as tobacco. In this case, tobacco was hypothesized to react to additional elicitors, perhaps other elicitin-like proteins (Kamoun 2001; Kamoun et al. 1998b, 1999e). Indeed, in P. infestons, a complex set of elicitin-like genes was isolated using polymerase chain reaction (PCR) amplification with degenerate primers, low stringency hybridizations, and random sequencing of cDNAs (Fabritius et al. 2002; Kamoun et al. 1997a, and b, 1999b). In total, eight elicitin and elicitin-like genes (termed inf genes) have been reported so far in P. infestons. All these genes encode putative extracellular proteins that share the 98- amino-acid (aa) elicitin domain corresponding to the mature class I elicitins, such as INFl. This domain is defined as the elicitin domain in many protein motif databases, such as pfam (PF00964) (Bateman et al. 2002) and InterPro (IPR002200) (Mulder et al. 2003). Six inf genes (inf2A, inflB, inf5, info, inf7, and M-25) encode predicted proteins with a C-terminal domain in addition to the N- terminal elicitin domain. Sequence analysis of these C-terminal domains revealed a high frequency of serine, threonine, alanine, and proline. The amino-acid composition and the distribution of these four residues indicated the likely occurrence of clusters of (9- linked glycosylation sites (Kamoun et al. 1997a). These proteins are likely to form a "lollipop on a stick" structure in which the O- glycosylated domain forms an extended rod that anchors the protein to the cell wall, leaving the extracellular N-terminal domain exposed on the cell surface (Jentoft 1990). Therefore, these atypical INF proteins may be surface- or cell-wall-associated glycoproteins that could interact with plant cells during infection.

Fig. 1. Occurrence of inf2 sequences in Phytophthora spp. DNA blot containing 20 m of HindIII-digested total DNA from 13 isolates representing nine Phytophthora spp. (i.e., P. infestons isolates 88069, 90128, and IPO-0; P. mirabilis CBS 678.85, CBS136.86, and CBS150.88; P. phaseoli CBS 556.88; P. pamsitica 18; P. cactorum 436; P. palmivora 10; P. porri HH; P. cinnamomi 2; and P. vignae 20853) was hybridized with a probe from the elicitin domain of inf2 which hybridizes to both inf2A and inf2B. Molecular marker sizes are shown on the left in kilobases.p>

The intrinsic biological function of elicitins in Phytophthora spp. has long remained a mystery. Conclusive evidence finally emerged when it was demonstrated that class I elicitins bind sterols, such as ergosterol, and function as sterol-carrier proteins (Boissy et al. 1999; Mikes et al. 1997, 1998; Vauthrin et al. 1999). Consequently, elicitins were hypothesized as having a biological function of essential importance to Phytophthora spp. because they cannot synthesize sterols and must assimilate them from external sources (Hendrix 1970). In addition, phospholipase activity was assigned to elicitin-like proteins from P. capsici with significant similarity to INF5 and INF6 (Nespoulous et al. 1999), suggesting a general lipid binding or processing role for the various members of the elicitin family (Osman et al. 200Ia). Other work by Osman and associates (200Ib) using elicitin mutants altered in sterol binding revealed that sterol loading is important for specific-binding to a plasma membrane receptor and induction of the HR in tobacco. More recently, another gene with similarity to elicitins, M-25, was reported to be induced during mating in P. infestans (Fabritius et al. 2002).

In this article, we report the molecular and functional characterization o P. infestans genes encoding the class III elicitin-like INF2A and INF2B proteins (Kamoun et al. 1997a). We examined the occurrence of inf2 sequences in P. infestans and other Phytophthora spp., the full genomic sequence of the inflA gene, and the expression of the inf2 genes in various isolates of P. infestans and during the P. infestans-tomato interaction. In addition, we compared INF2 proteins to the well-characterized INFl elicitin for their elicitor activity using both the binary Potato virus X (PVX) expression system (agroinfection) and Agmbacte\riwn tumefaciens transient transformation assays (agroinfiltration). Last, we characterized the defense responses induced by INF2 in N. tabacum and showed that, similar to INFl, necrosis induction by INF2A in N. benthamiana requires the ubiquitin ligase-associated protein SGTl. These experiments revealed significant differences in intensity, specificity, and consistency of HR induction among INFl, INF2A, and INF2B. We found that tobacco, but not N. benthamiana, responded to INF2B. This could explain differences in resistance to P. infestans observed for these two species.

RESULTS

Occurrence of inf2 sequences in Phytophthora spp.

The products of the inflA and inf2B genes form a distinct class of elicitins previously designated class III (Kamoun et al. 1997a). In order to assess the occurrence and distribution of sequences similar to inf2 across a range of Phytophthora spp., total DNA from 13 isolates representing nine Phytophthora spp. was hybridized at low stringency with a probe from the elicitin domain of inf2 (Fig. 1). This inf2 probe hybridized to both inf2A and inf2B; however, under similar hybridization conditions, no cross-hybridization between this probe and other P. infestans inf elicitin genes was observed. All tested isolates of the examined Phytophthora spp. appeared to contain from two to eight Hindlll bands homologous to the in/2 elicitin domain (Fig. 1). Similar hybridization experiments on total DNA from four additional oomycete species (Pythiwn aphanidermatum, isolate 28; P. sylvaticum, 933; Aphanomyces leavis, 465.64; and Saprolegnia ferax, G-1295) did not yield any detectable signals (data not shown). Therefore, it appears that inf2-like elicitin genes may occur as a small genus-specific gene family and are conserved in all tested species of Phytophthora.

Isolation and characterization of inf2A genomic region.

To determine the genomic structure of the inflA gene, a λEMBLS genomic library of Phytophthora infestans 88069 (Pieterse et al. 1993) was hybridized with the in/2 probe. A total of live hybridizing clones were identified. DNA from these clones was digested with Hindlll, blotted, and hybridized with the infl probe (data not shown). Three of the clones contained a 1.7-kb Hindlll hybridizing band that co-migrated with one of the bands revealed on the total DNA blot (Fig. I, lane 1). The other two positive clones were not reconfirmed in subsequent hybridizations. The 1.7-kb Hindlll fragment was subcloned into pBluescript SK- and fully sequenced using a primer walking approach. The nucleotide sequence revealed a 1,654-bp Hindltt fragment (GenBank accession number AY693804) and was found to contain a 558-bp open reading frame (ORF) that perfectly matched the ORF in the inf2A cDNA sequence, suggesting that, similar to other elicitin genes from Phytophthora spp., the inflA gene does not contain introns. Examination of the nucleotide sequence upstream of the ORF revealed, at position -50 relative to the ATG start codon, sequence TCTCATT CTACAATTT, similar to the oomycete transcriptional start site motif (Kamoun 2003; McLeod et al. 2004; Pieterse et al. 1993). Downstream of the ORF, the 51 -bp sequence that corresponded to the 3' untranslated region contained a potential polyadenylation signal ATTAAA, located 18 bp downstream of the TAA stop codon. No significant similarities between the noncoding sequences of the inflA gene and the noncoding sequences of other elicitin genes were noted. In this screening, no genomic clone corresponding to inf2B was recovered from the genomic library.

Occurrence of inf2A and inf2B in P. infestans.

To determine whether the inf2A and inf2B genes are conserved in P. infestans, BamHI-digested total DNA from a collection of 16 isolates of P. infestans (Kamoun et al. 1998a) was sequentially hybridized with gene-specific probes containing 3' end portions of the inflA and inf2B cDNAs as well as a specific 3' end probe of the infl cDNA (Kamoun et al. 1997a) (Fig. 2). All probes lack a BamHI site. One to two genomic copies for each of the inf2A and inf2B genes could be detected in all 16 P. infestans isolates examined, whereas a single infl band was revealed. In some isolates, both the inf2A and inflB probes revealed bands with lower intensity. No cross- hybridization was noted between the infl probes and other inf elicitin genes under the hybridization conditions used; therefore, we expected these bands to contain inf2-like sequences. However, we cannot conclude at this stage whether the faint bands correspond to additional alleles or gene copies of infl or to pseudogene sequences. GE900083, an isolate from Germany, lacked the strongly hybridizing inflA band observed in all other isolates.

inf2A and inflB mRNAs are produced by all tested P. infestans isolates.

A small number of field isolates of P. infestans are deficient in mRNA of the elicitin gene infl and in INFl protein (Kamoun et al. 1998a). To determine whether these and other isolates show altered levels of inflA and inflB mRNA, total RNA from the 16 isolates of P. infestans examined in Figure 2, as well as P. infestans 88069, was sequentially hybridized with the inflA, inflB, and inf] gene- specific probes (Fig. 3). All tested isolates showed detectable levels of inflA and inflB mRNA, suggesting that infl mRNAs are produced by all tested P. infestans isolates, including the two isolates DDR7602 and DDR7702 that previously were shown to lack infl mRNA (Kamoun et al. 1998a). However, in this experiment, levels of infl mRNA were variable between the examined isolates. GE900083, the isolate that lacked the major inf2A band in the Southern blot analyses, also produced a signal for inf2A mRNA.

inf2A and inflB are expressed during the P. infes tans-tomato interaction.

We determined the expression profiles of inflA and inf2B genes during a time course infection of tomato by P. infestcms using semi- quantitative reverse transcription (RT)-PCR. Gene-specific primers for inf2A, inj2B, In/1, and the constitutive elongation factor 2-a (efld) gene were used. Expression of infZA was detected 3 days after inoculation, whereas expression of infl and inJ2B was observed as early as 1 day after inoculation (Fig. 4). In contrast to infl, which reached the highest levels of expression at the latest time point (day 4), inf2A expression peaked at day 3 and inf2B at days 3 and 4. These results show that both in/2 genes are expressed during P. infeslans colonization of tomato.

Heterologous expression of inf2A and inf2B in plants using agroinfection of PVX.

To express the inf2 genes in plant cells and examine their clicitor activity, we first used the PVX system, which proved effective in assaying the HR-inducing activity of the infl gene (Kamoun et al. 1999a; Qutob et al. 2002; Torto et al. 2003). A fusion between the signal sequence of the PR-1a gene of tobacco (Hammond-Kosack et al. 1995) and the sequence of the 98-aa elicitin domain of 1NF2A and INF2B (Kamoun et al. 1997a) was cloned into in the binary PVX vector pGRIOo (Lu et al. 2003). Two recombinant plasmids, pGR106-INF2A and pGR106-INF2B, were confirmed to contain the correct inserts by DNA sequencing and subsequently were introduced into Agrobacterium tumefaciens to allow delivery of PVX in plants via agroinfection. A. tumefaciens strains carrying the pGR106-INF2 constructs were inoculated side-by-side on mature leaves of N. tabacum (tobacco, cv. Xanthi) and N. benthamiana and compared with a strain carrying a pGR106 derivative expressing (he PRla::infl construct (pGR106-INFl) (Fig. 5). In tobacco, all three strains induced rapid symptoms consisting of localized HR-like necrotic lesions. In contrast, N. benthamiana leaves challenged with the pGR106-INFl and pGR106-INF2A strains exhibited localized necrotic lesions, whereas the pGR106-INF2B strain failed to cause visible symptoms (Fig. 5).

Fig. 2. Occurrence of the inf2A, infZB, and infl sequences in isolates of Phytophthora infestons, DNA blot containing BamHI- digestcd total DNA from P. infestons isolates (1) DDR760I, (2) DDR7602, (3) DDR7702, (4) GER7401, (5) GER8451, (6) GER8501, (7) GER860I, (8) 46210, (9) 66006, (10) 68308, (11) 70001, (12) UK7225, (13) UK7818, (14) IT8001, (15) GE900083, and (16) GE900089 (Kamoun et al. I998a) was hybridized with specific probes from the A, inf2A, B, inf2B, and C, infl genes. The approximate sizes of the hybridizing bands arc shown on the right in kilobases.

In addition to these qualitative differences, there was significant variation in the efficiency and extent of elicitation of necrotic symptoms between the elicitins (Table 1). On responding plants, the pGR106-INFl and pGR106-INF2B strains were very consistent, resulting in necrotic symptoms in at least 93% of the inoculation sites (Table 1). In contrast, the pGR106-INF2A strain was poorly efficient, resulting in necrotic symptoms in 36 and 70% of the inoculation sites on tobacco and N. benthamiana, respectively. Also, the pGR106-INF2A strain induced smaller necrotic lesions averaging 0.9 and 1.9 mm in tobacco and N. benthamiana, respectively, whereas the pGR106-INFl and pGR106-INF2B strains induced lesions ranging from 3.2 to 5.8 mm in size on responding plants. Inoculations of all plants with mock and vector controls never resulted in necrotic symptoms.

To determine the significance of our observations, statistical analysis was performed on necrotic lesion size data. Analysis of variance using the generalized linear models procedure and subsequent t test comparisons indicated significant differences between the elicitors tested on both N. benthamiana and N. tabacum (Table 1).

Fig. 3. Occurrence of the inf2A, inflB, and infl inRNA in isolates of Phytophthora infestons. RNA blots containing total RNA from DDR7601 (1), DDR7602 (2), DDR7702 (3), GER740I (4), GER8451 (5), GER850I (6), GER860I (7), 46210 (8), 66006 (9), 68308 (10), 70001 (11), UK7225 (12), UK7818 (13), IT8001 (14), GE900083 (15), G\E900089 (16) and 88069 (17) were hybridized with specific probes from the inf2A, inf2B, infl, and actA genes. The approximate sizes of the inf and actA transcripts are shown on the right.

Fig. 4. Expression of Phytophthom infestons inf2A, inf2B, and infl during infection of tomato. Total RNA from P. infestans- infected leaves of tomato O, 1, 2, 3, and 4 days after inoculation, and P. infestons mycelium (My) grown in a synthetic medium were used in reverse-transcription polymerase chain reaction amplifications as described in the text. Amplification of the P. infestons elongation factor 2 (ef2 α) was used as a control Io determine the integrity of the RNA.

Fig. 5. Agroinfection assays. Symptoms observed on A, Nicntiana tabacum (tobacco) and B, N. benthamiana leaves after inoculation with Agrobacterium tumefaciens containing the binary Potato virus X (PVX) vector expressing Phytophthora infestons inf genes. Inoculated leaves were photographed 10 days after inoculation with A. tumefaciens containing, from left to right, the binary PVX vector pGR106, pGR106-INFl, pGR106-INF2A, and pGR106-INF2B.

To confirm the lack of response of N. benthamiana to INF2B, we repeated the agroinfection inoculations on individual young seedlings, an assay that is more sensitive than mature leaf inoculations because it allows systemic spread of the recombinant PVX and enhanced accumulation of the inf transcripts (Torto et al. 2003). Inoculation of N. benthamiana seedlings with the pGR106- INF2B strain consistently failed to result in any necrotic symptoms and always resulted in mosaic virus symptoms similar to those obtained with the empty vector strain. In contrast, both the pGR106- INFl and pGR106-lNF2A strains induced necrotic lesions starting 6 days after inoculation (data not shown).

Together, these results show that, unlike tobacco, N. benthamiana does not respond to INF2B, and suggest that INF2A may constitute a weaker HR elicitor than INFl and INF2B.

Heterologous expression of inf2A and inflB in plants using agroinfiltration.

To validate the elicitor activity of INF2A and INF2B and further compare it to INFl, we used agroinfiltration to express the three inf genes in plant cells. The PRla'.'.inf gene fusions were transferred to a Cauliflower mosaic virus (CaMV) 35S promoter and a potato proteinase-II terminator cassette in a T-DNA binary vector as described in the methods. A. tumefaciens strains carrying the various p35S-INF constructs were infiltrated into young and fully expanded leaves of N. tabacum (cv. Xanthi) and M benthamiana (Fig. 6). As negative controls, A. tumefaciens carrying pGUSi, which contains a β-glucuronidase gene interrupted by an intron (Hood et al. 1993), as well as buffer solutions were used. In N. tabacum, confluent necrosis in the entire infiltrated areas appeared 2 days following infiltration of the p35S-INF2A-, p35S-INF2B-, and p35S- INF1-carrying strains. In contrast, in N. benthamiana, only the A. tumefaciens strain carrying p35S-lNFl consistently induced necrosis, generally starting at 3 to 4 days after infiltration. In repeated side-by-side infiltrations of N. benthamiana leaves with the p35S- INFl and p35S-INF2 strains, the p35S-INF2B strain did not induce necrotic symptoms. However, occasionally, the p35S-INF2A construct caused necrosis in N. benthamiana. The negative control strain carrying pGUSi and the buffer solutions did not induce necrosis in both tobacco and N. benthamiana. These results confirm that N. benthamiana does not respond to INF2B and that INF2A may act as a weaker HR elicitor on this plant species.

Table 1. Recombinant Potato virus X expressing w/elicitin genes induce variable levels of necrosis on Nicotiana tabacum and N. benthtimitina(z)

Fig. 6. Agroinfiltration assays. Symptoms observed on Nicotiima tabacum (tobacco) (left panel) and N. benthaniiiina (right panel) leaves after infiltration with Agrohacterium tuntefaciens containing binary vectors expressing Phytophthoni infestons in/ genes. Inoculated leaves were photographed 6 days after inoculation with A. tumefaciens containing the binary vector p35S-INF2A (top left section of the leaves), p35S-INF2B (bottom left), p35S-INFI (top right), and the negative control pGUSi (bottom right).

INF2B induces PRIa and Bgl2 expression in tobacco.

To assess whether the necrotic response elicited by the INF2 proteins is associated with the induction of plant defense response genes, we wound inoculated leaves of a transgenic tobacco line carrying the GUS reporter gene driven by the promoter of the pathogenesis-related genes Bgl2 (PR2) (Livne et al. 1997) with A. tuinefaciens strains carrying pGR106-TNFl, pGR106-INF2A, and pGR106- INF2B (Fig. 7A). Negative controls consisted of the A. tuinefaciens strain carrying the vector pGR106 and mock inoculations. GUS histochemical staining of inoculated leaves showed some blue staining in the pGR 106 treatment, suggesting that the vector strain induces low levels of Bgl2 expression. However, the pGR106-INFl strain and, particularly, the pGR106-INF2B strain consistently induced stronger and larger areas of GUS staining than the vector control in 31 and 38% of the inoculation sites, respectively. The pGR106-lNF2A strain did not consistently induce different GUS staining than the controls.

We also performed Northern blot analyses using RNA isolated from leaf discs surrounding inoculation sites of a nontransgenic tobacco line using the same treatments as in the Bgl2::GUS experiment (Fig. 7B). Hybridization of the blots with probes of the pathogenesis- related gene PRIa and the constitutive gene α-tubulin revealed moderate induction of PRIa by the vector construct. Nevertheless, both pGR106-INF1 and pGR106-INF2B elicited increased levels of PRIa expression. These experiments suggest that, similar to INFl, INF2B induces the expression of the pathogenesis-related genes PRIa and Bgl2 in tobacco. However, no significant induction by INF2A could be demonstrated under these experimental conditions.

SGTl is required for HR elicitation by INF2A.

Peart and associates (2002) demonstrated that the ubiquitin ligase-associated protein SGTl is required for HR induction by INFl in N. benlhamiana. To test whether response to INF2A also requires SGTl, we used Tobacco rattle virus (TRV) to silence SGTI in N. benthamiana (Huitema et al. 2004; Peart et al. 2002; Ratcliff et al. 2001). For this purpose, we infiltrated young N. benthamiana plants (five-leaf stage) with A. tumefaciens strains containing the binary vector pBintrao (TRV RNAl) mixed with strains carrying the empty pTVOO vector (TRV RNA2) or pTVOO:SGTl (Peart et al. 2002). Three weeks after infiltration, we performed challenge inoculations using agroinfiltration (Fig. 8A) or agroinfection (Fig. 8B) as described above. In both experiments, INFl consistently induced the HR on plants inoculated with the TRV vector but not on the TRV:SGT1 plants. Similarly, INF2A induced the HR in 20 to 50% of the inoculations in plants treated with the TRV vector but not on the TRV:SGT1 plants. As noted earlier, 1NF2B did not induce necrosis in N. benthamiana. These results suggest that, similar to INFI, the HR induced by INF2A in N. benthamiana is SGT1-dependent.

Fig. 7. Induction of defense response genes in tobacco by INFi and INF2. A, Histochemical GUS assay of a leaf from transgenic tobacco line carrying a Bgl2:GUS construct. The leaf was wound- inoculated with a toothpick only (Wo) as well as with Agwbacterium tumefaciens strains carrying pGRlOG (Wt), pGR106-INFl, pGR106- INF2A, and pGR106-INF2B. The picture illustrates a representative leaf stained 8 days after inoculation. B, Northern blot hybridization of RNA isolated from tobacco leaves (cv. Xanthi) that were wound-inoculated with a toothpick only (Wo) or toothpick inoculated with A. tumefaciens strains carrying pGR106 (Wt), pGRI06- lNFl, pGR106-INF2A, and pGR106-INF2B. The blot was hybridized with probes from the defense gene PRIa and the constitutive gene ot- tubulin (tub). Total RNA was harvested from leaf discs surrounding the inoculation sites immediately al'ter the onset of necrosis. Different leaves were used for the different treatments.

DISCUSSION

Elicitins form a ubiquitous family of structurally related proteins in Phytophthora spp. In P. infestans, eight elicitin and elicitin-like genes (inf genes) corresponding to distinct classes have been reported (Fabritius et al. 2002; Kamoun et al. 1997a, and b, 1999b). So far, most studies on P. infestons elicitins have focused on the 98-aa canonical elicitin, INFl (class Ia) (Kamoun et al. 1997a; 1998a, and b, 1999b; Kanzaki et al. 2003; Sasabe et al. 2000; Sharma et al. 2003). In this article, we report the molecular and functional characterization of the inf2 class (class III) of elicitin-like genes from P. infestans (Kamoun et al. 1997a). Our main finding is that variation in the resistance of Nicotiana spp. to P. infestans is shadowed by variation in the response to INF elicitins. The ability of tobacco, but not N. benthamiana, to respond to INF2B could explain differences in resistance to P. infestans observed for these two species.

Despite the rapid accumulation of sequence data from numerous organisms, elicitin-like genes and proteins have been identified only in the oomycete genera, Phytophthora and Pythium. In the genus Phytophthora, production of the 10-kDa class I elicitins is quasi- ubiquitous and has been attributed to more than 30 species so far (Kamoun et al. 1994; Ponchet et al. 1999). The Southern blot hybridizations illustrated in Figure 1 suggest that the inf2 class of elicitin-like genes is similarly widespread because inf2-like sequences were detected in all nine Phytophthora spp. examined. In addition, we also identified sequences highly similar to infl by searching the expressed sequence tag (EST) database of P. sojae (Qutob et al. 2000, 2003). These results indicate that the infl class of elicitin-like \genes occurs as a small conserved family in Phytophthora spp.

Fig. 8. Symptoms observed in Nicotiana benthamiana silenced for the ubiquitin ligase-associated gene SGTl following agroinfiltration and Potato virus X (PVX) agroinfection with infl and in/2 constructs. N. benthamiana plants were first inoculated with Agrobacterium tumefaciens carrying the Tobacco rattle virus vector (TRV) or a TRV:SGT1 construct (TRViSGTl), and then challenged after 3 weeks with A, A. tumefaciens carrying vector (top left), p35S- INFl (top right), p35S-INF2A (bottom left), and p35S-INF2B (bottom right) constructs, or B, A. tumefaciens carrying the binary PVX vector pGR106, pGR106-INFl, and pGR106-INF2A. Leaves in panel A were photographed 5 days after the secondary agroinfiltration. The bars in panel B correspond to the percentage of A. tumefaciens binary PVX inoculation sites showing the hypersensitive response over time (n = 40).

Using Southern blot analyses with gene-specific probes, one to two genomic copies of the inf2A and inf2B genes could be detected in 16 different P. infestons isolates. In addition, inf2 mRNA was ubiquitously present in these P. infestons isolates, although at variable levels. The biological basis and significance of this variation remains unclear. The two P. infestons isolates previously described as naturally deficient in INFl production (Kamoun et al. 1998a) were found to produce inf2 mRNA. In addition, inf2 sense and antisense transformants that showed no detectable levels of infl mRNA (Kamoun et al. 1998b) were found to be unaltered in infl mRNA using Northern blot hybridizations (van West et al. 1999). These results suggest that downregulation of infl mRNA does not correlate with altered levels of infl mRNA.

We monitored gene expression levels of both infl A and inflB during P. infestons-tomato interactions. Semiquantitative RT-PCR experiments revealed that both inflA and inflB are expressed during infection of tomato, indicating that these proteins are functionally relevant to P. infestons pathogenesis. Expression patterns of the infl genes in planta were slightly different from those of infl, which tends to peak late during infection (Kamoun et al. 1997b). However, more precise methods for measuring gene expression need to be applied to confirm these results prior to speculating on their biological implications.

Comparative analyses of elicitor activity of INF1, 1NF2A, and INF2B using PVX agroinfection and agroinfiltration revealed that, similar to INFl and other elicitins, INF2A and INF2B induced HR- like symptoms on tobacco. However, using these assays, differences in HR induction were noted among the three elicitors in both tobacco and N. benthamiana. A significant difference in specificity of HR induction was obtained for INF2B, which, unlike INFl and 1NF2A, failed to induce necrosis on N. benthamiana in both assays (Figs. 4 and 5; Table 1). On the other hand, INF2A only occasionally induced the HR in N. benthamiana using agroinfiltration, and induced small and inconsistent necrotic lesions using agroinfection (Table 1). These results suggest that expression of inflA in N. benthamiana via these transient assays may not be efficient enough to consistently result in necrosis. Alternatively, unknown environmental or host factors may affect the level of expression or response to INF2A in N. benthamiana, resulting in the inconsistent responses. In any case, these results support the view that INF2A is an overall weaker HR elicitor than INFl and INF2B. This conclusion also is supported by the experiments described in Figure 7 that show that INF2B and INFl but not INF2A induced the expression of the defense genes PRIa and Bgl2 in tobacco. However, the extent to which these differences are significant to natural P. infestans-plant interactions remains to be determined.

Fig. 9. Multiple alignment of the elicitin domain of selected Phytophthora elicitin and elicitin-like protein highlighting the major structural features. Multiple alignment of elicitin sequences from Phytophlhora ciyptogea cryptogein (CRY-B) and il infestons (INFl, INF2A, and INF2B) was conducted using the program CLUSTAL-W (J. D. Thompson, EMBL, Heidelberg, Germany). Identical and similar amino acids are shaded in gray. Residue numbers flank the sequences. The secondary structure elements indicated above the sequences (six α helices, Ω loop, and two antiparallel β-sheets) correspond to CRY-B as described in Boissy and associates (1996). Residues in blue were shown by Boissy and associates (1999) to interact with an ergosterol substrate. Residues in red differ between INF2A and 1NF2B. Residue numbers flank the sequences.

We determined that the ubiquitin ligase-associated protein SGTl is required for HR induction by INF2A, as previously shown for INFl (Peart et al. 2002). SGTl has emerged as a central player in R gene- mediated HR signaling in plants as diverse as barley, Ambidopsis thaliana, and N. bentlwmiana (Peart et al. 2002; Shirasu and Schulze- Lefert 2003; Tor et al. 2003). Using TRV-mediated gene silencing, Peart and associates (2002) found that, unlike abiotic inducers of cell death, all examined pathogen-derived elicitors required SGTl for HR induction. Therefore, the result that INF2A-induced necrosis is SGTl dependent suggests that this protein is likely to induce a typical HR similar to the one induced by the better-characterized INFI protein and other HR elicitors. However, considering the differences highlighted above, the extent to which INF2 and INFl induce similar cell death pathways in Nicotiana spp. remains to be determined.

The ability of tobacco, but not N. benthamiana, to respond to INF2B could explain differences in resistance to P. infestans observed for these two species (Kamoun 2001; Kamoun et al. 1998b). P. infestans strains engineered for INFl-deficiency by antisense gene silencing were found to reach significant levels of biomass and colonization in N. benthamiana but not in a number of other Nicotiana spp., including tobacco (Kamoun et al. 1998b). This led to the hypothesis that resistance to P. infestans in N. benthamiana is triggered mainly by INFl, whereas the resistance reaction observed in tobacco may involve additional elicitor or avirulence factors (Kamoun 2001 ; Kamoun et al. 1998b). An attractive hypothesis is that the inability of N. benthamiana to respond to INF2B, contributes to the difference in response to INF!-deficient strains between these two Nicotiana spp. Future experiments using P. infestans strains silenced for a combination of inf genes should help assess the contribution of the inf2 genes to avirulence on Nicotiana spp.

The three-dimensional structure of cryptogein, the major basic elicitin (class Ib) of P. cryptogea, was determined both as a native protein and complexed with crgosterol (Boissy et al. 1996, 1999; Fefeu et al. 1997; Gooley et al. 1998). The main features of the structure of cryptogein, three disulfide bridges, a beak-like motif formed by two antiparallel beta sheets, and an Ω-loop, are likely to be conserved among the P. infestons elicitins examined in this study (Fig. 9). Ergosterol binding to cryptogein occurs in a hydrophobic pocket and involves 15 aa residues in cryptogein (Boissy et al. 1999). All these residues are fully conserved among cryptogein, INFl, and other class I clicilins (Fig. 9) (Boissy et al. 1999). However, 6 of these 15 aa are replaced in 1NF2A and 1NF2B, including Tyr87 (replaced by Leu) which was shown experimentally to be important in stcrol binding and HR induction in cryptogein (Osman et al. 2001b). This marked difference in amino acid composition of the hydrophobic pocket suggests that 1NF2 may bind different substrates from class 1 elicitins, perhaps lipid molecules other than sterols. Variation in substrate binding also could explain lhe difference in elicitor activity between INF2 and class I elicitins, because sterol loading is important for the ability to specifically bind a plasma membrane receptor and induce the HR in tobacco (Osman et al. 2001b).

The differences in HR-inducing activity observed for INF elicitins in N. benthamiana and tobacco and the availability of facile functional assays suggest that these genes are ideal for probing structure-function relationships in elicitor proteins. Differences in activity of INF2A and INF2B were observed even (hough their elicitin domains differ only by 3 aa (Fig. 9). INF2A appeared weaker than INFl and 1NF2B in inducing the HR on tobacco, resulting in lower frequencies of necrosis induction and smaller necrotic lesions when delivered through PVX (Fig. 4; Table 1). On the other hand, INF2B consistently failed to induce the HR on N. benthamiana even though it functioned as a potent elicitor in tobacco (Figs. 4 and 5; Table 1). In INF2B, Ser65 is replaced by GIy and Glu93 is replaced by Lys. Both of these residues are located in the α helices and are nol implicated in sterol binding. However, they are predicted to be surface exposed and are variable among class I elicitins (Fig. 9). Our results suggest that these residues are important for specific HR activity in N. benthamiana and the overall elicitor activity in tobacco. Future domain swapping and amino acid exchange experiments should help determine the role of these residues in elicitin activity.

The Nicotiana genes involved in recognition of elicitins have not yet been identified and, consequently, one can only speculate about the molecular basis of the differences between tobacco and N. benthamiana with respect to their response to INF2 elicitins. Elicitin recognition genes in Nicotiana spp. could be members of a variable R gene family, similar to those described in numerous plants to mediate HR induction by pathogen elicitors (Bent 1996; Meyers et al. 1999; Michelmore and Meyers 1998; Staskawicz el al. 1995). The difference observed between tobacco and N. benthamiana also in\dicates that, similar Io lhe phenotypic expression of resistance (Kamoun et al. 1998b), the genetic basis of Nicotiana resistance to P. infestans could be diverse. Perhaps, recognition of species-specific elicitors, such as INF elicitins, by an arsenal of R genes forms the basis of resistance of Nicotiana spp. to P. infestans (Kamoun 2001). Considering this diversity, the P. infestans-Nicotiana spp. pathosystem appears ideal for the dissection and comparative analyses of the molecular basis of nonhost recognition in closely related species.

MATERIALS AND METHODS

Microbial strains and culture conditions.

The various P. infestans isolates used in this study were described previously (Kamoun et al. 1998a). P. infestans isolates were cultured routinely on rye agar medium supplemented with 2% sucrose (Caten and Jinks 1968) or in still cultures in the synthetic medium described by Kamoun and associates (1994).

Escherichia coli XLl-Blue and DH5α were used in most experiments and were routinely grown at 37C in Luria-Bertani media (Sambrook et al. 1989). A. tumefaciens strains EHA105 (Hood et al. 1993) and GV3101 (Holsters et al. 1980) were used. All bacterial DNA transformations were conducted by electroporation.

DNA manipulations and plasmid constructions.

DNA manipulations and screening of the λEMBL3 library were conducted essentially as described elsewhere (Ausubel et al. 1987; Sambrook et al. 1989). Total DNA of P. infestons was isolated from mycelium grown in liquid culture as described previously (Pieterse et al. 1991). Alkaline DNA transfer to Hybond N+ (Amersham, Arlington Heights, IL, U.S.A.) and Southern hybridizations were performed at 65C as described elsewhere (Ausubel et al. 1987; Sambrook et al. 1989). Filters were typically washed at 55C in 0.5x SSC (75 mM NaCl and 7.5 mM sodium citrate) (1x SSC is 0.15 M NaCI plus 0.015 M sodium citrate) except for the blot shown in Figure 1, which was washed at low stringency (room temperature in 2x SSC). Dideoxy chain-termination sequencing was carried out using an AmpliCycle sequencing kit (Perkin-Elmer, Foster City, CA, U.S.A.).

Plasmid pFB60 was obtained by subcloning a gel-purified 1.7-kb Hindlll fragment from an /n/2A-containing XEMBL3 clone into pBluescript SK- (Stratagene, San Diego, CA, U.S.A.). Sequencing of the full insert of pFB60 was conducted using vector primers as well as a series of internal sequencing primers.

Plasmids pGR106-lNF2A and pGR106-lNF2B were constructed by cloning PCR-amplified DNA fragments corresponding to a fusion between the signal sequence of the PR-1a gene of tobacco (Hammond- Kosack et al. 1995) and the sequence of the 98-aa elicitin domain of INF2A and INF2B (Kamoun et al. 1997) into the CM site of pGR106 (Lu et al. 2003) using the overlap extension strategy described by Kamoun and associates (1999a). The oligonucleotides used in the PCRs are PVX-F (5'-AATCAATCACAGTGTTGGCTTG C-3') and PR-INF2A (5'- GGCGAGCACGTCTCGGCACGGC AAGAGTGGGATATTAC -3'); and PR-1NF2B (5'- CTTGCCG TGCCGAGACGTGCTCGCCCACG-3') and INF2-RSC (5'-G TGGAGCTCATCGATCACGACGAGGAGCACTTCTTGGA3'). Sad and CIcA restriction sites were introduced in INF2-RSC and are underlined. The resulting recombinant plasmids, pGR106-INF2A and pGR106-INF2B, were confirmed by DNA sequencing to have a PRla::inf2 fusion inserted in the sense orientation with regard to the duplicated PVX coat protein promoter. The pGR106-INFl plasmid was constructed by cloning the PRla::infl fusion sequence (Kamoun et al. 1999a) into the CM site of pGR 106.

For agroinfiltration experiments, plasmids p35S-INFI (previously named plnfl) was described earlier (Kamoun et al. 2003). p35S-INF2A and p35S-INF2B were constructed by cloning PCR-amplified DNA fragments corresponding to the PR-1a::inf fusions from the respective pGR106-INF constructs as Ncol and Sad fragments into pAvr9 (Van der Hoorn et al. 2000). The oligonucleotides used in the PCRs are PRl-FNCO (5'-GCATCCATGGGATTTGTTCTCTTTTCACAA-3') and INFl- RSAC (5'-GGCGAGCTCTCATAGCGACGCACACGT AG-3') for PRla::infl and 1NF2- RSC for PRla::inf2. The introduced Ncol and Sad restriction sites are underlined. The resulting p35S-INF plasmids were confirmed by DNA sequencing to contain intact PRla::inf ORFs flanked by the CaMV 35S promoter and the Ω Tobacco mosaic virus (TMV) leader on the 5' side and the potato proteinase-II terminator region on the 3' end.

RNA manipulations, Northern blot hybridizations, and RT-PCR analyses.

Total RNA was isolated from P. infeslans mycelium using the guanidine hydrochloride extraction method (Logemann et al. 1987), and from N. tabucum using the Trizol RNA extraction protocol following the manufacturer's recommendations (Gibco-BRL, Bethesda, MD, U.S.A.). For Northern blot analyses, 10 to 15 g of total RNA was denatured at 50C in 1 M glyoxal, dimethyl sulfoxide, and 10 mM sodium phosphate, electrophoresed, and transferred to Hybond N+ membranes (Amersham) (Ausubel et al. 1987; Sambrook et al. 1989). Hybridizations were conducted at 65C in 0.5 M sodium phosphate buffer, 7% sodium dodecyl sulfide, and 1 mM EDTA. Filters were washed at 55C in 0.5x SSC for the Phytophthora blots or at 65C in 0.5x SSC for the plant blots. For the RT-PCR experiments, cDNA derived from a P. infestans-lomato time-course experiment was generated as previously described (Tian et al. 2004). Equal amounts of cDNA were subjected to PCR amplification using the following primers: INFlTEV-F (5'-GGGAAATCGATACCAC GTGCACCACCTCGCA-3'), INFlTEV- R (5'-GGGAAATC GATTAGCGACGCACACGTAGACG-3'), INF2TEV-F (5'-G GGAAATCGATGAGACGTGCTCGCCCACGGAC-3'), and lNF2A-Rnew (5'- CGCATAGCACTTAACAAGCCGCGGCG G-3'). Primers described by Torto and associates (2002) were used for amplification of ef2α.

Hybridization probes.

Probes from the inf2 genes were obtained as gel-purified DNA fragments containing essentially the signal peptide and elicitin domain (amino acids 1 to 126) of the infl A and inf2B cDNA inserts, generated by digestions of the original cDNA plasmids (Kamoun et al. 1997a,b) using appropriate restriction enzymes. A probe from the act A gene from pSTA31 (Unkles et al. 1991) was used as a loading control. The PRIa gene probe was generated through PCR amplification of tobacco genomic DNA using the gene-specific primers PRl-tob-F (5'ATGGGATTTGTTCTCTTTTCACAA-3') and PRl-tob-R (5'GTATGGACTTTCGCCTCTATAATTAC-3'). A probe from the α-tubulin gene was amplified from an N. otophora cDNA clone using vector primers. Probes were radiolabeled with either α-32P-dATP or α-32P-dCTP using a random primer labeling kit (Gibco-BRL).

In order to obtain probes specific to the various genes, we used the primer extension strategy described by Kamoun and associates (1997b). Single-stranded, radiolabeled probe complementary to the 3' end untranslated region of the infl mRNA was generated by extending primer 1NF2-F1 (Kamoun et al. 1997b) from the gel-purified infl insert from pFB7. Single-stranded, radiolabeled probes complementary to the 3' end untranslated region of the inf2A, and inf2B mRNAs, were generated by extending primer INF2-F2 (5'-CCACCGCGGCTT GTTAAG- 3') from XhoI-digcstcd pFB5 and pFB24, rcspccttively. The sequence corresponding to the TAA stop codon of the inf2A and inf2B ORFs is underlined. The labeling reactions were performed as previously described (Kamoun et al. 1997b).

PVX agroinfection assays.

Tobacco (cv. Xanthi) and N. benthamiana plants with fully expanded leaves were used for the agroinfection assays. Plants were cultured and maintained in a greenhouse with an ambient temperature of 22 to 25C and high light intensity. Inoculations were performed by dipping a wooden sterile toothpick in a recombinant A. tumefaciens GV3101 (pGR106-INF) colony grown on solid agar medium and wounding each leaf twice around the main vein. An excess of bacteria was used for the inoculations. Local necrotic symptoms were scored daily and typically stalled developing within 5 to 7 days after inoculation.

All constructs were re-evaluated on young N. benthamiana plants at approximately the three-to four-leaf stage (approximately 3 weeks old). Inoculations then were performed on two lower leaves by wounding each leaf twice around the main vein and near the base of the leaf with the A. tuinefaciens strain. Mosaic, local, and systemic necrotic symptoms were scored daily and typically started developing within 5 to 7 days after inoculation.

Agroinfiltration assays.

Recombinant A. tuinefaciens strains containing the various binary plasmids were prepared for agroinfiltration as described previously (Kapila et al. 1997; Van der Hoorn et al. 2000). Cultures were infiltrated into young and fully expanded leaves. Most p35S-INFl and p35S-INF2 infiltrations were conducted side by side and repeated at least three times.

GUS assays.

We used a transgenic tobacco line (cv. Samsun NN) carrying a Bgl2::GUS reporter construct. The selected line (gglb-12333), generated by Livne et al. (1997) to express a chimeric gglbSO promoter (basic β-13-glucanase, GenBank accession number X53600) fused to the GUS reporter gene, contains the gglbSO promoter region between positions -1,233 and +19. Histochemical GUS staining was performed using 2 mM 5bromo-4-chloro-3-indolyl-β-D- glucuiOnic acid (X-Gluc) (Rose Scientific, Edmonton Alberta, Canada) as described previously by Huitema and associates (2003).

TRV-silencing experiments.

Agmbacteriuin strains carrying pBINTRAo (RNA 1 vector), pTV00 (RNA 2 vector), and pTV00:SGTl (Peart et al. 2002; Ratcliff et al. 2001) were prepared for agroinfiltration as described above, and mixed in a 2:1 RNA 1/RNA 2 ratio. The SGTl insert corresponds to the NbSGT1.1 gene (GenBank accession number AF516180). Mixed cultures were incubated for at least 2 h before infiltration. The youngest fully expanded leaves of N. benthamiana plants (five-leaf stage) were infiltrated with the Agrobacterium suspensions using necdleless syringes. Chall\enge inoculations using agroinfiltration or PVX agroinfection assays were started 3 weeks after TRV inoculation and performed as described above.

ACKNOWLEDGMENTS

This work was supported by a Netherlands Technology Foundation (STW) grant coordinated by the Life Sciences Foundation (SLW) WBl.3846, National Science Foundation Plant Genome Research Program grant DBI-0211659, and state and federal funds appropriated to the Ohio Agricultural Research and Development Center, the Ohio State University. We are grateful to K. de Groot, S. Dong, D. Kinney, and H. Lindqvist for expert technical assistance; P. van West and Ii. Gaulin for useful comments; and 1. Malcuit and D. Baulcombe for useful advice and for providing the PVX and TRV vectors.

LITERATURE CITED

Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. 1987. Current Protocols in Molecular Biology. J. Wiley & Sons, New York.

Bateman, A., Birney, E., Cerruti, L., Durbin, R., Etwiller, L., Eddy, S.R., Griffiths-Jones, S., Howe, K. L., Marshall, M., and Sonnhammer, E. L. L. 2002. The Plain protein families database. Nucleic Acids Res. 30:276-280.

Bent, A. 1996. Plant disease resistance genes: Function meets structure. Plant Cell 8:1757-1771.

Birch, P. R. J., and Whisson, S. 2001. Phytophthora infestons enters the genomics era. Mol. Plant Pathol. 2:257-263.

Boissy, G., de La Fortelle, E., Kahn, R., Huet, J. C., Bricognc, G., Pernollet, J. C., and Brunie, S. 1996. Crystal structure of a fungal elicitor secreted by Phytophthora cryptogea, a member of a novel class of plant necrotic proteins. Structure 4:1429-1439.

Boissy, G., O'Donohue, M., Gaudemer, O., Perez, V., Pernollet, J. C., and Brunie, S. 1999. The 2.1 A structure of an elicitin- ergosterol complex: A recent addition to the Sterol Carrier Protein family. Protein Sci. 8:11911199.

Caten, C. E., and Jinks, J. L. 1968. Spontaneous variability of single isolates of Phytophthora infestans. I. Cultural variation. Can. J. Bot. 46:329-347.

Dangl, J. L., Dietrich, R. A., and Richberg, M. H. 1996. Death don't have no mercy: Cell death programs in plant-microbe interactions. Plant Cell 8:1793-1807.

Dangl, J. L., and Jones, J. D. 2001. Plant pathogens and integrated defence responses to infection. Nature 411:826-833.

Fabritius, A. L., Cvitanich, C., and Judelson, H. S. 2002. Stage- specific gene expression during sexual development in Phytophthora infestans. Mol. Microbiol. 45:1057-1066.

Fefcu, S., Bouaziz, S., Huet, J. C., Pernollet, J. C., and Guittet, E. 1997. Three-dimensional solution structure of beta cryptogein, a beta elicitin secreted by a phytopathogenic fungus Phytophthora cryptogea. Protein Sci. 6:2279-2284.

Fry, W. E., and Goodwill, S. B. 1997a. Re-emergence of potato and tomato late blight in the United States. Plant Dis. 81:1349-1357.

Fry, W. E., and Goodwin, S. B. 1997b. Resurgence of the Irish potato famine fungus. Bioscience 47:363-371.

Gooley, P. R., Keniry, M. A., Dimitrov, R. A., Marsh, D. E., Keizer, D. W., Gayler, K. R., and Grant, B. R. 1998. The NMR solution structure and characterization of pH dependent chemical shifts of the beta-elicitin, cryptogein. J. Biomol. NMR 12:523-534.

Hammond-Kosack, K. E., Staskawicz, B. J., Jones, J. D. G., and Baulcombe, D. C. 1995. Functional expression of a fungal avirulence gene from a modified potato virus X genome. MoI. Plant-Microbe Interact. 8:181185.

Heath, M. C. 2000. Nonhost resistance and nonspecific plant defenses. Curr. Opin. Plant Biol. 3:315-319.

Hendrix, J. W. 1970. Sterols in growth and reproduction of fungi. Annu. Rev. Phytopathol. 8:111-130.

Holsters, M., Suva, B., Van Vliet, F, Genetello, C., De Block, M., Dhaese, P., Dcpicker, A., Inze, D., Engler, G., Villaroel, R., Van Montagu, M., and Schell, J. 1980. The functional organization of the nopaline A. tume-faciens plasmid pTiC58. Plasmid 3:212-230.

Hood, E. E., Gelvin, S. B., Mclchers, L. S., and Hoekema, A. 1993. New Agrobacterium helper plasmids for gene transfer to plants. Transgenic Res. 2:208-218.

Huitema, E., Bos, J. I. B., Tian, M., Win, J., Waugh, M. E., and Kamoun, S. 2004. Linking sequence to phenotype in Phytophthora- pliint interactions. Trends Microbiol. 12:193-200.

Huitema, E., Vleeshouwers, V. G. A. A., Francis, D. M., and Kamoun, S. 2003. Active defence responses associated with non-host resistance of Arabidopsis thaliana to the oomycete pathogen Phytophthora infestans. Mol. Plant Pathol. 4:487-500.

Jentoft, N. 1990. Why are proteins O-glycosylated? Trends Biochcm. Sci. 15:291-294.

Kamoun, S. 2001. Nonhost resistance to Phytophthora'. Novel prospects for a classical problem. Curr. Opin. Plant Biol. 4:295- 300.

Kamoun, S. 2003. Molecular genetics of pathogenic oomycetes. Eukaryot. Cell 2:191-199.

Kamoun, S., Hamada, W., and Huitema, E. 2003. Agrosuppression: A bioassay for the hypersensitive response suited to high-throughput screening. MoI. Plant-Microbe Interact. 16:7-13.

Kamoun, S., Honee, G., Weide, R., Lauge, R., Kooman-Gersmann, M., de Groot, K., Covers, F, and de Wit, P. J. G. M. 1999a. The fungal gene Avr9 and the oomycete gene infl confer avirulence to potato virus X on tobacco. MoI. Plant-Microbe Interact. 12:459-462.

Kamoun, S., Hraber, P., Sobral, B., Nuss, D., and Covers, F. 1999b. Initial assessment of gene diversity for the oomycete pathogen Phytophthora infestans based on expressed sequences. Fungal Genet. Biol. 28:94-106.

Kamoun, S., Huitema, E., and Vleeshouwers, V. G. A. A. I999c. Resistance to oomycetes: A general role for the hypersensitive response? Trends Plant Sci. 4:196-200.

Kamoun, S., Lindqvist, H., and Covers, F. 1997a. A novel class of elicitin-like genes from Phytophthora infestans. MoI. Plant-Microbe Interact. 10:1028-1030.

Kamoun, S., van der Lee, T., van den Berg, G., de Groot, K. E., and Covers, F I998a. Loss of production of the elicitor protein INFl in the clonal lineage US-I of Phytophthora infestons. Phytopathology 88:1315-1323.

Kamoun, S., van West, P., de Jong, A. J., de Groot, K., Vleeshouwers, V., and Covers, F. 1997b. A gene encoding a protein elicitor of Phytophthora infestons is down-regulated during infection of potato. MoI. Plant-Microbe Interact. 10:13-20.

Kamoun, S., van West, P., Vleeshouwers, V. G., de Groot, K. E., and Covers, F. 1998b. Resistance of Nicotiana benthamiana to Phytophthora infestans is mediated by the recognition of the elicitor protein INFl. Plant Cell 10:1413-1426.

Kamoun, S., Young, M., Forster, H., Coffey, M. D., and Tyler, B. M. 1994. Potential role of elicilins in the interaction between Phytophthora: Species and tobacco. Appl. Environ. Microbiol. 60:1593- 1598.

Kamoun, S., Young, M., Glascock, C., and Tyler, B. M. 1993. Extracellular protein elicitors from Phytophthora'. Host- specificity and induction of resistance to fungal and bacterial phytopathogens. MoI. Plant-Microbe Interact. 6:15-25.

Kanzaki, H., Saitoh, H., Ito, A., Fujisawa, S., Kamoun, S., Katou, S., Yoshioka, Y., and Terauchi, R. 2003. Cytosolic HSP90 and HSP70 are essential components of INF!-mediated hypersensitive response and non-host resistance to Pseudomonas cichorii in Nicotiana benthamiana. MoI. Plant Pathol. 4:383-391.

Kapila, J., de Rycke, R., Van Montagu, M., and Angenon, G. 1997. An Agrobacterium-mediated transient gene expression system for intact leaves. Plant Sci. 122:101-108.

Livne, B., Faktor, O., Zeitounc, S., Edelbaum, O., and SeIa, I. 1997. TMVinduced expression of tobacco β-glucanase promoter activity is mediated by a single, inverted, GCC motif. Plant Sci. 130:159-169.

Logemann, J., Schell, J., and Willmitzer, L. 1987. Improved method for isolation of RNA from plant tissue. Anal. Biochem. 163:16- 20.

Lu, R., Malcuit, I., Moffett, P., Ruiz, M. T., Peart, J., Wu, A. J., Rathjen, J. P., Bendahmane, A., Day, L., and Baulcombe, D. C. 2003. High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance. EMBO (Eur. MoI. Biol. Organ.) J. 22:5690-5699.

McLeod, A., Smart, C. D., and Fry, W. E. 2004. Core promoter structure in the oomycete Phytophthora infestans. Eukaryot. Cell 3:91-99.

Meyers, B. C., Dickerman, A. W., Michelmore, R. W., Sivaramakrishnan, S., Sobral, B. W., and Young, N. D. 1999. Plant disease resistance genes encode members of an ancient and diverse protein family within the nucleotide-binding superfamily. Plant I. 20:317-332.

Michelmore, R. W., and Meyers, B. C. 1998. Clusters of resistance genes in plants evolve by divergent selection and a birth-and-death process. Genome Res. 8:1113-1130.

Mikes, V, Milat, M. L., Ponchet, M., Panabieres, F., Ricci, P., and Blein, J. P. 1998. Elicitins, proteinaceous elicitors of plant defense, are a new class of sterol carrier proteins. Biochem. Biophys. Res. Commun. 245:133-139.

Mikes, V, Milat, M. I.., Ponchet, M., Ricci, P., and Blcin, J. P. 1997. The fungal elicitor cryptogcin is a sterol carrier protein. FEBS (Fed. Eur. Biol. Soc.) Lett. 416:190-192.

Mulder, N. J., Apweiler, R., Attwood, T. K., Bairoch, A., Barrell, D., Bateman, A., Binns, D., Biswas, M., Bradley, P., Bork, P., Bucher, P., Copley, R. R., Courcelle, E., Das, U., Durbin, R., Falquet, L., Fleischmann, W., Griffiths-Jones, S., Haft, D., Harte, N., HuIo, N., Kahn, D., Kanapin, A., Krestyaninova, M., Lopez, R., Letunic, I., Lonsdale, D., Silvenloinen, V., Orchard, S. E., Pagni, M., Peyruc, D., Ponting, C. P., Selengut, J. D., Servant, E, Sigrist, C. J. A., Vaughan, R., and Zdobnov, E. M. 2003. The InlerPro Database, 2003 brings increased coverage and new features. Nucleic Acids Res. 31:315-318.

Nespoulous, C., Gaudemer, O., Huct, J. C., and Pernollct, J. C. 1999. Characterization of elicitin-like phospholipases isolated from Phytophthora capsici culture filtrate. FEBS (Fed. Eur. Biol. Soc.) Lett. 452:400406.

Osman, H., Mikes, V., Milat, M. L., Ponchet, M., Marion, D., Frange, T., Maume, B. F., Vauthrin, S., and Blein, J. P. 200Ia. Fatty acids bind to the fungal elicitor cryptogein and c\ompete with sterols. FEBS (Fed. Eur. Biol. Soc.) Lett. 489:55-58.

Osman, H., Vauthrin, S., Mikes, V., Milat, M. L., Panabieres, F., Marais, A., Brunie, S., Maume, B., Ponchet, M., and Blein, J. P. 2001b. Mediation of elicitin activity on tobacco is assumed by elicitin-sterol complexes. MoI. Biol. Cell. 12:2825-2834.

Peart, J. R., Lu, R., Sadanandom, A., Malcuit, I., Moffett, P., Brice, D. C., Schauser, L., Jaggard, D. A., Xiao. S., Coleman, M. J., Dow, M., Jones, J. D., Shirasu, K., and Baulcombe, D. C. 2002. Ubiquitin ligase-associated protein SGTl is required for host and nonhost disease resistance in plants. Proc. Natl. Acad. Sci. U.S.A. 6:10865-10869.

Pieterse, C. M. L, Riach, M. R., Bleker, T, van den Berg Velthuis, G. C. M., and Covers, F. 1993. Isolation of putative pathogenicity genes of the potato late blight fungus Phytophthora infestans by differential screening of a genomic library. Physiol. MoI. Plant Pathol. 43:69-79.

Pieterse, C. M. J., Risseeuw, E. P., and Davidse, L. C. 1991. An in planta induced gene of Phytophthora infestons codes for ubiquitin. Plant Mol. Biol. 17:799-811.

Ponchet, M., Panabieres, F., Milat, M.-L., Mikes, V., Montillet, J.-L., Suty, L., Triantaphylides, C., Tirilly, Y., and Blein, J.-P. 1999. Are elicitins cryptograms in plant-Oomycetc communications? Cell. Mol. Life Sci. 56:1020-1047.

Qutob, D., Hraber, P. T., Sobral, B. W., and Gijzen, M. 2000. Comparative analysis of expressed sequences in Phytophthora sojae. Plant Physiol. 123:243-254.

Qutob, D., Huitema, E., Gijzen, M., and Kamoun, S. 2003. Variation in structure and activity among elicitins from Phytophthora sojae. MoI. FMantPathol.4:ll9-124.

Qutob, D., Kamoun, S., and Gij/en, M. 2002. Expression of a Phytophthora sojae necrosis-inducing protein occurs during transition from biotrophy to necrotrophy. Plant J. 32:361-373.

Ratcliff, F., Martin-Hemandez, A. M., and Baulcombe, D. C. 2001. Tobacco rattle virus as a vector for analysis of gene function by silencing. Plant J. 25:237-245.

Ricci, P., Bonnet, P., Huet, J.-C., Sallantin, M., Beauvais- Cante, F., Bruneteau, M., Billard, V., Michel, G., and Pernollet, J.- C. 1989. Structure and activity of proteins from pathogenic fungi Phytophthora eliciting necrosis and acquired resistance in tobacco. Eur. J. Biochem. 183:555-563.

Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, NY.

Sasabe, M., Takeuchi, K., Kamoun, S., lchinose, Y, Covers, F., Toyoda, K., Shiraishi, T., and Yamada, T. 2000. Independent pathways leading to apoptotic cell death, oxidative burst and defense gene expression in response to elicitin in tobacco cell suspension culture. Eur. J. Biochem. 267:5005-5013.

Schiermeier, Q. 2001. Russia needs help to fend off potato famine, researchers warn. Nature 410:1011.

Sharma, P. C., Ito, A., Shimizu, T., Terauchi, R., Kamoun, S., and Saitoh, H. 2003. Virus-induced silencing of WlPK and SIPK genes in Nicotiana benthamiana cause reduced resistance against an incompatible bacterial pathogen but no effect on HR triggered by INFI. MoI. Genet. Genom. 269:583-591.

Shattock, R. C. 2002. Phytophthora infestons: Populations, pathogenicity and phenylamides. Pest Manage. Sci. 58:944-950.

Shirasu, K., and Schulze-Lefert, P. 2003. Complex formation, promiscuity and multi-functionality: Protein interactions in disease- resistance pathways. Trends Plant Sci. 8:252-258.

Smart, C. D., and Fry, W. E. 2001. Invasions by the late blight pathogen: Renewed sex and enhanced fitness. Biol. Invas. 3:235-243.

Staskawicz, B. J., Ausubel, F. M., Baker, B. J., ElHs, J. G., and Jones, J. D. G. 1995. Molecular genetics of plant disease resistance. Science 268:661-667.

Tian, M., Huitema, E., da Cunha, L., Torto-Alalibo, T., and Kamoun, S. 2004. A Kazal-like extracellular serine protease inhibitor from Phytophthora infestons targets the tomato pathogenesis-related protease P69B. J. Biol. Chem. 279:26370-26377.

Tor, M., Yemm, A., and Holub, E. 2003. The role of proteolysis in R gene mediated defence in plants. MoI. Plant Pathol. 4:287-296.

Torto, T., Li, S., Styer, A., Huitema, E., Testa, A., Gow, N. A. R., van West, P., and Kamoun, S. 2003. EST mining and functional expression assays identify extracellular effector proteins from Phytophthora. Genome Res. 13:1675-1685.

Torto, T., Rauser, L., and Kamoun, S. 2002. The pipg1 gene of the oomycete Phytophthora infestons encodes a fungal-like enclopolygalacturona.se. Curr. Genet. 40:385-390.

Unkles, S. E., Moon, R. P., Hawkins, A. R., Duncan, J. M., and Kinghorn, J. R. 1991. Actin in the oomycetous fungus Phytophthora infestans is the product of several genes. Gene 100:105-112.

Van der Hooin, R. A., Laurent, E, Roth, R., and De Wit, P. J. G. M. 2000. Agroinfiltration is a versatile tool that facilitates comparative analyses of Aw9/Cf-9-induced and Avr4/Cf-4-induced necrosis. MoI. PlantMicrobe Interact. 13:439-446.

van West, P., Kamoun, S., van't Klooster, J. W., and Covers, F. 1999. liilcrnucleargene silencing in Phytophthora. MoI. Cell 3:339- 348.

Vauthrin, S., Mikes, V., Milat, M. L., Ponchet, M., Maume, B., Osman, H., and Blein, J. P. 1999. Elicilins trap and transfer sterols from micelles, liposomes and plant plasma membranes. Biochim. Biophys. Acta 1419:335-342.

AUTHOR-RECOMMENDED INTERNET RESOURCE

The Sainsbury Lab at the John Innes Center, D. Batilcomb's VlGS protocol webpage: www.jic.bbsrc.ac.uk/Sainsbury-Lab/dcb/Serviccs/ vigsprotocol.htm

Edgar Huitema,1 Vivianne G. A. A. Vleeshouwers,2 Cahit Cakir,1 Sophien Kamoun,1,2 and Francine Govers2

1 Department of Plant Pathology, The Ohio State University, Ohio Agricultural Research and Development Center, Wooster, U.S.A.; 2 Laboratory of Phytopathology, Wageningen University, The Netherlands

Submitted 19 August 2004. Accepted 1


Source: Molecular Plant-Microbe Interactions; MPMI

More News in this Category


Related Articles



Rating: 3.5 / 5 (10 votes)
Rate this article:
1/52/53/54/55/5

User Comments (0)

Comment on this article

Your Name
Text from the image
Comment
max 1200 chars
* All fields are required

redOrbit Friends