• E-mail
  • Print
  • Comment
  • Font Size
  • Digg
  • del.icio.us
  • Discuss article

Characterization of a Novel Plant Growth-Promoting Bacteria Strain Delftia Tsuruhatensis HR4 Both As a Diazotroph and a Potential Biocontrol Agent Against Various Plant Pathogens

Posted on: Friday, 18 March 2005, 03:00 CST

Abstract

A novel, plant growth-promoting bacterium Delftia tsuruhatensis, strain HR4, was isolated from the rhizoplane of rice (Oryza saliva L., cv. Yueguang) in North China. In vitro antagonistic assay showed this strain could suppress the growth of various plant pathogens effectively, especially the three main rice pathogens (Xanthomonas oryzae pv. oryzae, Rhizoctonia solani and Pyricularia oryzae Cavara). Treated with strain HR4 culture, rice blast, rice bacterial blight and rice sheath blight for cv. Yuefu and cv. Nonghu 6 were evidently controlled in the greenhouse. Strain HR4 also showed a high nitrogen-fixing activity in N-free Dbereiner culture medium. The acetylene reduction activity and ^sup 15^N^sub 2^-fixing activity (N^sub 2^FA) were 13.06 C^sub 2^H^sub 4^ nmol ml^sup -1^ h^sup -1^ and 2.052 ^sup 15^Na.e.%, respectively. The nif gene was located in the chromosome of this strain. Based on phenotypic, physiological, biochemical and phylogenetic studies, strain HR4 could be classified as a member of D. tsuruhatensis. However, comparisons of characteristics with other known species of the genus Delftia suggested that strain HR4 was a novel dizotrophic PGPB strain.

2004 Elsevier GmbH. All rights reserved.

Keywords: Delftia tsuruhatensis', Rice; Plant growth-promoting bacteria; Characterization

Introduction

Beneficial free-living soil bacteria in the rhizosphere are generally referred to as plant growth-promoting bacteria (PGPB) and are found in association with the roots of various plants [21]. The high concentration of bacteria around the roots, i.e., in the rhizosphere, presumably occurs because of the presence of high levels of nutrients exuded from the roots of most plants that can support bacterial growth and metabolism [23]. Besides rhizosphere PGPB, PGPB also include phyllosphere PGPB [4] and endophytic PGPB [13].

In recent years, much attention has been paid to natural methods of crop growing in expectation of moving toward agriculturally and environmentally sustainable development [68]. PGPB promote plant growth due to their abilities in nitrogen fixation, phytohormone production, solubilization of phosphorus and disease control [38], and therefore have the potential to reduce the application of agro- chemicals and maintain biotic diversity in the plant associated bio- community. This fascinating area of research has an impact on the study of a number of fundamental aspects of both plant growth and development and the strategies employed by soil microorganisms, while providing us with promising approaches to alter both agricultural and horticultural practices dramatically [21].

Numerous PGPB have been isolated from the tissues of many crop plants [20,21,46]. In addition, PGPB have also been isolated from deep-water rice [74], wild rice [7,15] and cultivated rice in the tropics [25,7O]. Recently, four PGPB strains isolated from rice in California were found to possess potential for control of seedling diseases of rice and for plant growth promotion [2].

In this work, we characterized a novel diazotrophic PGPB, strain HR4, which was isolated from the rhizoplane of rice (Oryza satica L., cv. Yueguang). Phenotypic characterization and phylogenetic analysis indicated its affiliation to Delftia tsuruhatensis. Its plantpromoting roles were assayed for inhibiting various plant pathogens, biocontrol activity and nitrogen fixing activity. To the authors' knowledge, HR4 is the first identification of a plant growth-promoting bacterium which inhibits various plant pathogens and shows N2fixing activity in the Delftia genus.

Materials and methods

Bacterial strains and culture

Strain HR4 was isolated in our lab from the rhizoplane of rice (Oryza satica L., cv. Yueguang), a widely planted rice cultivar in the temperate climatic regions in western Beijing (China). D. tsuruhataensis ATCC BAA554^sup T^ was purchased from NBRC (Japan). Escherichia coli K^sub 12^ AS 1.365 was provided by Professor Shuangjiang Liu, Institute of Microbiology, Chinese Academy of Sciences. Klebsiella pneumoniae was provided by Professor Jiudi Li, Institute of Botany, Chinese Academy of Sciences. Routinely, the strains were cultivated in Luria-Bertani (LB) medium [60], unless otherwise indicated below.

Cell and colony morphology

Gram reactions were determined according to standard microbiological procedures [19]. Spore formation was determined by malachite green staining of cells grown on LB agar. PHB formation was determined by the Sudan black B staining method. Cell morphology and size were observed by scanning electron microscope (S570, HITACHI, Japan) and transmission electron microscope (H600, HITACHI, Japan) as previously described [1].

Biochemical characterization

Basal medium used for C assimilation tests contained 0.1% (NH^sub 4^)^sub 2^SO^sub 4^, 0.3% KH^sub 2^PO^sub 4^, 0.7% K^sub 2^HPO^sub 4^ and 0.01% MgSO^sub 4^.47H^sub 2^O. The carbon sources listed in Table 1 were sterilized by filtration (pore size 0.2 m, Jinteng Company, China) and added aseptically to the autoclaved-based medium at final concentration of 0.2% (wt./vol.). The strain was incubated for 24 h at 30 C on a shaker at 180 rpm and subcultured in the same medium three times. The growth was determined by measuring OD^sub 600^. Basal medium was used as the negative control and a basal medium containing 0.2% DL-malate was used as the positive control. All experiments were done in triplicate.

Arginine dihydrolase, catalase, oxidase, urease, lipase (Tween 80 hydrolysis) activity assays and formation of indole, production of 3- ketolactose, V.P. test, gelatin liquefaction test, and starch hydrolysis test were performed according to standard microbiological procedures [19]. Denitrification and nitrite reduction were determined by the method of Stanier et al. [66].

Determination of cellular fatty acid composition

Cellular fatty acid composition of HR4 and D. tsuruhataensis ATCC BAA-554^sup T^ was analyzed using the Sherolock system (Midi Company, USA) and according to the manufacturer's instructions.

DNA base composition and DNA-DNA hybridization

Genomic DNA from strain HR4 and D. tsuruhataensis ATCC BAA- 554^sup T^ was extracted and purified according to the method of Marmur [50] except for the addition of protease K in the SDS- treatment step. DNA base compositions were determined by thermal denaturation [51] using a spectrophotometer (DU800, BECKMEN, Germany), DNAs from E. coli K^sub 12^ were used as standard for the calibration of the T^sub m^ value. DNA-DNA hybridizations were carried out according to De Ley et al. [12] and Huss et al. [32].

Phylogenetic analysis

The 16S rRNA gene was amplified by PCR with primers (Pf 5'- CGGGATCCAGAGTTTGATCCTGG CTCAG-3' and Pr 5'- CGGGATCCAAGGAGGTGATCCAGCC-3', corresponding to positions 8-27 and 1525-1541, respectively, of the 16S rDNA of E. coli) [16], as previously described [8] using Perkin-Elmer GeneAmp PCR System 9700 (Perkin-Elmer Co., USA). The PCR amplification products were purified and sequenced in Shanghai Sangon Biological Engineering Technology and Service Co. Ltd (China) using an ABI 373A DNA automated sequencer (Applied Biotech, INC., USA).

Table 1. Differential characteristics of strain HR4, D. acidovorans ATCC 15668T and D. tsuruhatensisATCC BAA-554^sup T^

After alignment by CLUSTAL W, the phylogenetic analysis of the 16S rRNA gene sequence was performed using the SEQBOOT and DNADIST methods in the PHYLIP (version 3.5) software package [17]. The phylogenetic tree was constructed using the neighborjoining method [59] as implemented within the DNAMAN program. The clustering stability of the tree was evaluated by bootstrap analysis of 1000 data sets.

Acetylene reduction activity and ^sup 15^N^sub 2^ fixation activity assays

Acetylene reduction activity test in vitro and ^sup 15^N^sub 2^ fixation activity assays were performed as previously described [64] using a Varian-VISTA-6000 gas chromatograph and a MU-1305 mass spectrograph, respectively.

A modified version of Dobereiner N-free culture medium [14] was used in this study, which contained 10 g of sucrose, 5 g of malic acid, 0.1 g of K^sub 2^HPO^sub 4^, 0.4 g of KH^sub 2^PO^sub 4^, 0.2g of MgSO^sub 4^.7H^sub 2^O, 0.01 g of FeCl^sub 3^, 0.1g NaCl, 0.02 g CaCl^sub 2^.2H^sub 2^O, 0.02 g of Na^sub 2-^ MoO^sub 4^.2H^sub 2^O and 3 g agar per liter of deionized water, pH 7.0-7.2.

All the experiments were performed in triplicate, and the results were expressed as mean values: the standard deviations were less than 5%.

nif gene localization

Genomic DNA of strain HR4 was obtained by the method previously described. Total DNA of plasmid pSASO (containing nifHDK gene of K. pneumonias, provided by Professor Jiudi Li, Institute of Botany, Chinese Academy of Sciences) and the plasmid of HR4 were obtained according to the protocols described in Molecular Cloning [60].

Plasmid pSA30 was digested by EcoR I (Roche Diagnostics Corporation), and the nifHDK DNA fragment was collected by EZ Spin Column DNA Gel Extraction Kit (Shanghai Sangon Biological Engineering Technology and Service Co. Ltd., China). Premier nifHDK DNA labeling with digoxigenin-dUTP and spot blotting were operated according to the instruction manual of DIG High Prime DNA Labeling and Detection Starter Kit I (Roche \diagnostics Corporation). E. coli K12 was used as a negative control and plasmid pSASO was used as a positive control.

Antagonistic activity testing in vitro

Plant pathogens used in the in vitro antagonistic activity test are listed in Table 2. The antagonistic activity of HR4 in vitro was assayed on Potato Dextrose Agar (PDA) plates (9 cm dia) as previously described [2]. The growth inhibition was calculated after incubating 3-5 d at 28 C in darkness.

All the experiments were performed in triplicate, and the results were expressed as mean values: the standard deviations were less than 5%.

Table 2. In vitro antagonism of strain HR4

Evaluation of biocontrol activity in the greenhouse

Two susceptible rice varieties, Oryza saliva L. cv. Yuefu and Oryza saliva L. cv. Nonghu 6 were used for biocontrol activity assay. They were provided by the experimental station in China Agricultural University and China National Rice Research Institute (CNRRI), respectively.

The biocontrol activity of HR4 against rice blast [Pyricularia oryzae Cavara], rice bacterial blight [Xanthomonas oryzae pv. Oryzae (Ishiyama) Swing et al.] and rice sheath blight [Rhizoctonia solani Kuhn] was investigated in the greenhouse on the experimental farm in CNRRI.

For the treatment of rice plants with strain HR4, two methods described previously by Rangarajan et al. [57] were used: (1) soaking rice seeds in bacterial cultures (10^sup 8^ cfu/mL) before sowing and (2) foliar spray treatment with bacterial cultures (10^sup 8^ cfu/mL), 1 day before inoculating plant pathogens.

Rice seedlings were inoculated with P. oryzae Cavara at the one- and-a-half-leaf to two-leaf stage by spraying a conidial suspension containing 5 10^sup 4^ spores/mL onto the leaves. The plants were incubated in a moist chamber at 25 C for 20 h, followed by transfer to the greenhouse. Disease severity was scored 7 days after inoculation.

At the five-leaf stage, for inoculation of rice plants with X. oryzae pv. Oryzae (culture adjusted to 10^sup 9^ cfu/ mL), the leaf clipping method described by Kaufmann et al. [34] was used. For inoculation of plants with R. solani, a method described by Thara [71] was used. Sheath blight and bacterial blight symptoms were assessed 14 days after inoculation.

Control efficiency of rice disease by HR4 was calculated using the formula as followings:

% Control efficiency = (Difference in disease incidence between control and treated plants/Disease incidence in control) 100%.

Results

Morphology

Cells were Gram-negative, straight to slightly curved rods, occurring singly or in pairs, 0.5-1.2 2.60 -4.0 m, motile with scattered peritrichous flagella (Figs. 1 and 2) and poly-β- hydroxybutyrate (PHB) was accumulated in cells. Colony was low convex, smooth, with irregular diffused edges and griscent.

Biochemical characterization

Strain HR4 could utilize the following compounds as sole carbon sources: o-fructose, sodium butyrate, sodium D-gluconate, fumaric acid, β-hydroxybutyrate, sodium lactate, mannitol, sodium citrate, sodium acetate, Lglutamate, L-leucine, DL-malate and L- proline. But D- or Larabinose, betaine, D- or L-xylose, L-rhamnose, D-galactose, D-mannose, o-glucose, maltose, sucrose and n . butyl alcohol could not support its growth.

Fig. 1. Scanning electron micrograph of strain HR4 (bar = 5 m).

Fig. 2. Transmission electron micrograph of strain HR4 (bar= 1 m).

Catalase, oxidase, lipase were produced and nitrate was reduced. However, urease, arginine dihydrolase and 3-ketolactose were not produced. The following reactions were negative: starch hydrolysis, gelatin liquefaction, indole, V.P. test and denitrification. Strain HR4 could not grow at 41 C.

Characteristics differentiating strain HR4 from D. acidovorans ATCC 15668^sup T^ and D. tsuruhatensis ATCC BAA-554^sup T^ are shown in Table 1.

Cellular fatty acid compositions

The most abundant fatty acids C^sub 16:0^ (32.56%), C^sub 16:1^ (17.11%), C^sub 17:0^ cyclo (17.39%), C^sub 18:1^ (16.84%) in strain HR4 and C^sub 16:0^ (37.54%), C^sub 16:1^ (21.23%), C^sub 17:0^ cyclo (19.95), C^sub 18:1^ (13.45%) in strain BAA-554T were detected. C^sub 12:0^, C^sub 14:0^, C^sub 15:0^, C^sub 19:0^ cyclo were detected in small amounts. In addition, the major 3-OH acids in strain HR4 and strain BAA-554^sup T^ both were 3-OH C^sub 8:0^ (0.09%, 0.33%, respectively) and 3-OH C^sub 10:0^ (0.68%, 2.56%, respectively).

DNA base composition and DNA-DNA hybridization

The guanine-plus-cytosine (G + C) content of the DNA of strain HR4 was 62.7mol%. The hybridization rate between strain HR4 and D. tsuruhataensis ATCC BAA-554^sup T^ was 93.2%.

16S rDNA sequence and phylogenetic analysis

The complete 16S rDNA of strain HR4 (1498 bp) was sequenced and is available at GenBank under accession number AY302438. A phylogenetic tree (Fig. 3) was constructed based on an alignment of 1368bp of 16S rDNA sequences. Sequence similarities between strain HR4 and relatives were as follows: D. tsuruhatensis ATCC BAA- 554^sup T^, 99%; Delftia sp. AN3, 99%; D. acidovorans WDL34, 99%; D. acidovorans MCl, 99%; D. acidovorans BP2, 98%; D. acidovorans ATCC 15668^sup T^, 98%. The tree indicates that strain HR4 isapparently affiliated with the genus Delftia. The sequences of strains belonging to the genus Delftia form two distinct clusters. One cluster includes the sequences of D. acidovorans strains ATCC 15668^sup T^, BP2, MCl and so on. The sequences of strains HR4, ATCC BAA-554^sup T^ and AN3 are assigned to the other cluster. Therefore, the sequences of strains belonging to the genus Delftia can be divided in two distinct phylogenetic groups.

Nitrogen-fixing activity in culture

Strain HR4 showed a high nitrogen-fixing activity in N-free Dbereiner culture medium, with an acetylene reduction activity of 13.06 C^sub 2^H^sub 4^ nanomole C^sub 2^H^sub 4^ per milliliter of bacterial culture per hour (nmol mL^sup -1^h^sup -1^) measured by the acetylene reduction assay method, and ^sup 15^N^sub 2^-fixing activity of 2.052 ^sup 15^Na.e.% measured by the ^sup 15^N tracer technique.

nif gene localization

HR4 genomic DNA and nifHDK-plasmid DNA spot blotting with a labeled probe showed that the nif gene is located in the chromosome of HR4 (Fig. 4).

Fig. 3. Phylogenetic tree showing relationships of strain HR4 and D. acidovorans (ATCC 15668^sup T^) and related species based on their 16S rDNA sequences. Burkolderia cepacia was used as the outgroup.

Fig. 4. Pattern of the total DNA after spot blotting with m/HDK probe 1, E. coli K^sub 12^; 2, pSA30; 3, plasmid of HR4; 4, genomic DNA of HR4.

Antagonistic activity testing in vitro

The in vitro antagonism assays (Table 2) showed that strain HR4 suppressed a variety of fungal plant pathogens, and exhibited anti- fungal activity against all 14 plant pathogens tested in this work. The highest level of growth inhibition was observed for R. solani, 92%; while the lowest level of growth inhibition was observed for Cladosporium cucumerinum Ell and Arthur, 29%. Strain HR4 exhibited strong anti-fungal activity against the three main rice pathogens: P. oryzae Cavara, X. oryzae pv. oryzae and R. solani, growth inhibition were 64%, 78% and 92%, respectively.

Evaluation of biocontrol activity in the greenhouse

After treatment of cv. Yuefu and cv. Nonghu 6 with strain HR4 by soaking seeds or foliar spraying, biocontrol of rice blast, rice bacterial blight and rice sheath blight were evident (Table 3), except in the case of treatment of Yuefu by foliar spraying for rice bacterial blight suppression (only 7%). The best biocontrol results were shown in the treatment of Nonghu 6 by foliar spraying for rice sheath blight suppression (58%) and treatment of Yuefu or Nonghu 6 by foliar spraying for rice blast (both 56%).

Table 3. Biocontrol activity in the greenhouse of HR4 for rice blast, bacterial blight and sheath blight

Discussion

The genus DeIftia was established by Wen et al. mainly based on 16S rRNA gene sequence. The type species of this genus D. acidovorans was formerly Pseudomonas acidovorans [75]. Although strain HR4 possessed phenotypic, physiological and biochemical differences with D. acidovorans and D. tsuruhatensis, it has very many common characteristics with D. tsuruhatensis. Hence, on the basis of the high 16S rDNA similarity and high DNA-DNA hybridization rate between strain HR4 and D. tsuruhataensis ATCC BAA-554^sup T^, it could be a novel strain of D. tsuruhatensis as a diazotrophic plant growth-promoting bacterium inhibiting various plant pathogens.

Based on our results, the original definition of the genus DeIftia should consider being emended as follows: its %GC is 62.7- 69mol% and it has polar, bipolar or scattered peritrichous tufts of 1-5 flagella.

To our knowledge, this is the first report on these novel functions in the genus Delftia. Moreover, this paper is also the first report for a new diazotroph genus isolated from rice plants.

Almost all strains of Delftia were obtained from soil [24], environments heavily contaminated with organic pollutants [10,53], or activated sludge of biological wastewater treatment plants [30,33,75]. They were often reported to be able to degrade harmful organic or inorganic compounds. D. acidovorans P4a was found to mineralize 2, 4-dichlorophenoxyacetic acid (2,4-D) and 2-methyl-4- chlorophenoxyacetic acid under alkaline conditions [29]. D. acidovorans WDL34 was found to be responsible for degrading 3,4-DCA (3,4-dichloroaniline), one of the intermediates of the linuron [3- (3,4dichlorophenyl)-1 -methoxy-1 -methylurea]-degradation process [10]. The terephthalate 1, 2-dioxygenase system (TERDOS) was found in cell extracts of a terephthalateassimilating D. tsuruhatensis T7. Purification and gene cloning of the oxygenase component of the TERDOS were completed [62,63]. Other enzymes isolated from D. acidovorans have been implicated in xenobiotic degradation pathways for compounds such as organophosphate [69], haloacetate[65], nitrobenzene [41], aniline or 3chloroaniline [6,45], phenoxypropionate or phenoxyacetate herbicides [54], 2-(4- Sulfophenyl) butyrate [61], 1, 3dichloropropene [33], and so on.

It is remarkable that a strain of the genus Delftia often reported to be able to degrade harmful compounds and obtained from environments heavily contaminated with organic pollutants or activated sludge is found as a PGPB in the rhizophere of rice. Furthermore, our latest experiments show that strain HR4 can reside inside of rice roots (cv. Yuefu) (unpublished data).

Root exudates, such as free amino acids, proteins, carbohydrates, alcohols, vitamins or hormones, are important sources of nutrients for the microorganisms present in the rhizosphere and participate in the colonization process through chemotaxis of soil microorganisms [28,48,49]. The capacity to colonize the rhizosphere of a host plant could be favored and even improved by several components of the root exudates [5,11]. In previous experiments, various organic acids, such as formic acid, acetic acid, propionic acid, butyric acid, lactic acid and pyruvic acid were found in root exudates of rice [42]. Further studies demonstrated that 1 g of fresh rice root can excrete 2.25 mg of organic acids into the rhizosphere [43]. All these organic acids can be favorite carbon sources for the acidophilic bacteria strains of the Delftia genus [75]. On the other hand, the pH may fall from near 6 in the bulk of the soil to less than 4 near the roots, as caused by some biochemical processes, such as nitrification and oxidation of Fe^sup 2+^ [36,58]. The acidified rhizosphere environment is highly advantageous to the colonization and growth of the Delftia strains. So, it is not surprising that they were found in the rhizosphere or rhizoplane of rice.

Rice is the staple in the diet of over 40% of the world's population (i.e., 2.65 billion), making it the most important food crop currently produced [31]. Two major factors affecting rice production and yield are losses due to shortage of N, diseases and pests [39].

It is well known that biological nitrogen fixation occurs in species of more than 100 genera distributing among several of the major phylogenetic divisions of prokaryotes (Eubacteria and Archaea) [40]. Our research demonstrates that a PGPB strain, HR4, with strong nitrogen fixation activity, can reside on the healthy rice rhizoplane. So using naturally occurring PGPB, such as HR4, to colonize a niche in which conditions appropriate for nitrogen fixation exist, we would have 'allowed evolution to do some of the work for us' [67].

The evaluation of results of the biocontrol activity of HR4 against rice blast, rice bacterial blight and rice sheath blight in the greenhouse indicated that HR4 as a PGPB strain is capable of suppressing some plant diseases. Now several mechanisms of disease suppression have been proposed, such as antibiotic metabolites production [3,18,35], siderophore production [55], production of lytic enzymes [56], or inducing systemic resistance [22]. PGPB may contribute to the control of microbial [4,44,73] or fungal [26,52,56] phytopathogens, plant-parasitic nematodes [26] and insects [46]. So, PGPB can be helpful in reducing the application of agro-chemicals and maintain biotic diversity in the plant associated bio-community. Isolation, characterization and application of stable diazotrophic PGPB has been one of the most important approaches for achieving nitrogen fixation and natural growth in non-legume crops [67].

Recently, there have been numerous reports on the use of PGPB, including crop (corn, cotton, etc.) PGPB, as biological control agents [9,27,37]. However, there has been little information on the occurrence of rice PGPB inhibiting so many plant pathogens, especially exhibiting strong anti-fungal activity against the three main rice pathogens. Our work shows that HR4 as a diazotrophic strain with biocontrol activities may be a potentially effective PGPB agent. However, the mechanisms of its antagonism are still to be demonstrated in further studies.

Acknowledgements

This work was supported by the National Natural Science Foundation of China (No. 30370032 and 30170035), Natural Science Foundation of Beijing (No. 5012004), Natural Science Foundation of Hebei (No. C2004000106) and Chinese Academy Sciences Project (KSCX2- SW-113). We thank Prof. Lanxiang Feng (Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Beijing, 100081, P.R. China) for her constructive advice on antagonistic activity assay and we also thank Prof. Ying Shen (China National Rice Research Institute, Hangzhou, 310006, P.R. China) for her assistance in the evaluation of biocontrol activity in the greenhouse for strain HR4.

References

[1] W. Achouak, T. Heulin, G. Villemin, J. Balandreau, Root colonization by symplasmata forming Enterobacter agglomerans, FEMS Microbiol. Ecol. 13 (1994) 287-294.

[2] T.B. Adhikari, C.M. Joseph, G. Yang, D.A. Phillips, L.M. Nelson, Evaluation of bacteria isolated from rice for plant growth promotion and biological control of seedling disease of rice, Can. J. Microbiol. 47 (2001) 916-924.

[3] M.G. Bangera, S. Thomashow, Characterization of a genomic locus required for synthesis of the antibiotic 2,4- diacetylphloroglucinol by the biological control agent Pseudomonas fluorescens Q2-87, Mol. Plant-Microbe Interact. 9 (1996) 83-90.

[4] Y. Bashan, L.E. de-Bashan, Protection of tomato seedlings against infection by Pseudomonas syringae pv. tomato by using the plant growth-promoting bacterium Azospirillum brasilense, Appl. Environ. Microbiol. 68 (2002) 2637-2643.

[5] M.F. Begonia, R.J. Kremer, Chemotaxis of deleterious rhizobacteria to birdsfoot trefoil, Appl. Soil Ecol. 11 (1999) 35- 42.

[6] N. Boon, J. Goris, P. De Vos, W. Verstraete, E.M. Top, Genetic diversity among 3-chloroaniline- and aniline-degrading strains of the Comamonadaceae, Appl. Environ. Microbiol. 67 (2001) 1107-1115.

[7] C. Chaintreuil, E. Giraud, Y. Prin, J. Lorquin, A. Ba, M. Gillis, P. De Lajudie, B. Dreyfus, Photosynthetic bradyrhizobia are natural endophytes of the African wild rice Oryza breviligulata, Appl. Environ. Microbiol. 66 (2000) 5437-5447.

[8] M.K. Chelius, E.W. Triplett, Immunolocalization of dinitrogenase reducetase produced by Klebsiella pneumonias in association with Zea mays L, Appl. Environ. Microb. 66 (2000) 783- 787.

[9] C.E. Chen, M. Bauske, G. Musson, R. Rodriguez-Kabana, J.K. Kloepper, Biological control of Fusarium wilt on cotton by use of endophytic bacteria, Biol. Control 5 (1995) 83-91.

[10] W. Dejonghe, E. Berteloot, J. Goris, N. Boon, K. Crul, S. Maertens, M. Hofte, P. De Vos, W. Verstraete, E.M. Top, Synergistic degradation of linuron by a bacterial consortium and isolation of a single linuron-degrading Variovorax strain, Appl. Environ. Microbiol. 69 (2003) 1532-1541.

[11] L.C. Dekkers, C.J.P. Bloemendaal, L.A. De Weger, C.A. Wijffelman, H.P. Spaink, J. Lugtenberg-Ben, A two-component system plays an important role in the root-colonizing ability of Pseudomonas fluorescens strain WCS365, Mol. Plant-Microbe Interact. 11 (1998) 45-56.

[12] J. De Ley, H. Cattoir, A. Reynaerts, The quantitative measurement of DNA hybridization from renaturation rates, Eur. J. Biochem. 12 (1970) 133-142.

[13] S. Di Fiore, M. Del Gallo, Endophytic bacteria their possible role in the host plant, In: J. Vanderleyden Istvan Fendrik, M. Del Gallo, M. De Zamaroczy (Eds.), Azospirillum VI and Related Microorganisms, Genetics, Physiology, Ecology, Heidelberg, Springer, 1995, pp. 169-187.

[14] J. Dbereiner, J.M. Day, P.J. Dart, Nitrogenase activity and oxygen sensitivity of the Paspalum notatum Azotobacter paspali association, J. Gen. Microbiol. 71 (1972) 103-116.

[15] A. Elbeltagy, K. Nishioka, T. Sato, H. Suzuki, B. Ye, T. Hamada, T. Isawa, H. Mitsui, K. Minamisawa, Endophytic colonization and in planta nitrogen fixation by a Herbaxpirillum sp. isolated from wild rice species, Appl. Environ. Microbiol. 67 (2001) 5285- 5293.

[16] R. Fani, C. Bandi, M. Bazzicalupo, M.T. Ceccherini, S. Fancelli, E. Gallori, L. Gerace, A. Grifoni, N. Miclaus, G. Damiani, Phylogeny of the genus Azospirillum based on 16S rDNA sequence, FEMS Microbiol. Lett. 129 (1995) 195-200.

[17] J. Felsenstein, PHYLIP-(Phylogeny Inference Package) version 3.5. Department of Genetics, University of Washington, Seattle, 1993.

[18] A.W. Fenton, P.M. Stephens, J. Crowley, M. O'Callaghan, F. O'Gara, Exploitation of gene(s) involved in 2,4- diacetylphloroglucinol biosynthesis to confer a new biocontrol capability to a Pseudomonas strain, Appl. Environ. Microbiol. 58 (1992) 3873-3878.

[19] P. Gerhardt, R.G.E. Murray, W.A. Wood, N.R. Krieg, Methods for general and molecular bacteriology, Washington, DC, American Society for Microbiology, 1994.

[20] B.R. Glick, Y. Bashan, Genetic manipulation of plant growth- promoting bacteria to enhance biocontrol of phytopathogens, Biotechnol. Adv. 15 (1998) 353-378.

[21] B.R. Glick, C.L. Patten, G. Holguin, D.M. Penrose, Biochemical and Genetic Mechanisms used by Plant Growth-Promoting Bacteria, London, Imperial College Press, 1999.

[22] B.R. Glick, The enhancement of plant growth by free living bacteria, Can. J. Microbiol. 41 (1995) 109-117.

[23] B.R. Glick, Phytoremediation: synergistic use of plants and bacteria to clean up the environment, Biotechnol. Adv. 21 (2003) 383- 393.

[24] A. Graff, S. Stubner, Isolation and molecular characterization of thiosulfate-oxidizing bacteria from an Italian rice field soil, Syst. Appl. Microbiol. 26 (2003) 445-452.

[25] P. Gyaneshwar, E.K. James, N. Mathan, P.M. Reddy, B. Reinhold-Hurek, J.K. Ladha, Endophytic colonization of rice by a diazotrophic strain of Serratia marcescens, J. Bacteriol. 183 (2001) 2634-2645.

[26] J. Hallmann, J.W. Kloepper, R. Rodriguez-Kabana, R.A. Sikora, Endophytic rhizobacteria as antagonists of Meloidogyne incognita on cucumber, Phytopathology 85 (1995) 1136.

[27] D.M. Hi\nton, C.W. Bacon, Enterobacter cloacae is an endophytic symbiont of corn, Mycopathologia 129 (1995) 117-125.

[28] F. Hiroyuki, S. Masao, O. Hidenori, U. Yasufumi, S. Tadayoshi, M. Tatsuhiko, Chemotactic response to amino acids of Fluorescent pseudomonas isolated from spinach roots grown in soils with different salinity levels, Soil Sci. Plant Nutr. 44 (1998) 1- 7.

[29] D. Hoffmann, S. Kleinsteuber, R.H. Muller, W. Babel, A transposon encoding the complete 2,4-dichlorophenoxyacetic acid degradation pathway in the alkalitolerant strain Delftia acidovorans P4a, Microbiology 149 (2003) 2545-2556.

[30] J. Hollender, U. Dreyer, L. Kornberger, P. Kampfer, W. Dott, Selective enrichment and characterization of a phosphorus-removing bacterial consoutium from activated sludge, Appl. Microbiol. Biotechnol. 58 (2002) 106-111.

[31] M. Hossain, K.S. Fischer, Rice research for food security and sustainable development in Asia: achievements and future challenges, Geojournal 35 (1995) 286-298.

[32] V.A.R. Huss, H. Fest, K.H. Schleifer, Studies on the spectrophotometric determination of DNA hybridization from renaturation rates, Syst. Appl. Microbiol. 4 (1983) 184-192.

[33] K. Katsivela, D. Bonse, A. Krger, C. Strmpl, A. Livingston, R.M. Wittich, An extractive membrane biofilm reactor for degradation of 1, 3-dichloropropene in industrial wastewater, Appl. Microbiol. Biotechnol. 52 (1999) 853-862.

[34] H.E. Kaufmann, A.P.K. Reddy, S.P.Y. Hseih, S.S. Merca, An improved technique for evaluating resistance of rice varieties to Xanthomonas oryzae, Plant Disease Reporter 57 (1973) 537-541.

[35] C. Keel, U. Schnider, M. Maurhofer, C. Voisard, J. Laville, U. Burger, P. Wirthner, D. Haas, G. Defago, Suppression of root diseases by Pseudomonas fluorescens CHAO: importance of the bacterial secondary metabolite 2,4-diacetylphloroglucionl, Mol. Plant-Microbe. Interact. 5 (1992) 4-13.

[36] G.J.D. Kirk, Modelling root-induced solubilization of nutrients, Plant Soil 255 (2002) 49-57.

[37] J.W. Kloepper, R. Rodrguez-Kbana, G.W. Zehnder, J.F. Murphy, E. Sikora, C. Fernndez, Plant root-bacterial interactions in biological control of soilborne diseases and potential extension to systemic and foliar diseases, Australasian Plant Pathol. 28 (1999) 21-26.

[38] J.W. Kloepper, B. Schippers, P.A.H.M. Bakker, Proposed elimination of the term endorhizosphere, Phytopathology 82 (1992) 726-727.

[39] D.K. Kundu, J.K. Ladha, Efficiency management of soil and biologically fixed N^sub 2^ in intensively cultivated rice fields, Soil Biol. Biochem. 27 (1995) 431-439.

[40] S. Lee, A. Reth, D. Meletzus, M. Sevilla, C. Kennedy, Characterization of a major cluster of nif, fix, and associated genes in a sugarcane endophyte, Acetobacter diazotrophicus, J. Bacteriol. 182 (2000) 7088-7091.

[41] D.J. Lessner, G.R. Johnson, R.E. Parales, J.C. Spain, D.T. Gibson, Molecular characterization and substrate specificity of nitrobenzene dioxygenase from Comamonas sp. strain JS765, Appl. Environ. Microbiol. 68 (2002) 634-641.

[42] J.P. Li, C.B. You, The associative nitrogen fixation in the rice rhizosphere, In: C.B. You (Ed.), The Associative Nitrogen Fixation in the Rice Rhizosphere, Beijing, Agricultural Publishing House, 1990, pp. 1-12.

[43] M. Lin, C.B. You, Root exudates of rice (Oryza sativa L.) and its interaction with Alcaligenes faecalis, Agric. Sci. China 22 (1989) 6-12.

[44] L. Liu, J.W. Kloepper, S. Tuzun, Induction of systemic resistance in cucumber against bacterial angular leaf spot by plant growth-promoting rhizobacteria, Phytopathology 85 (1995) 843-847.

[45] Z. Liu, H. Yang, Z. Huang, P. Zhou, S.I. Liu, Degradation of aniline by newly isolated, extremely aniline-tolerant Delftia sp. AN3, Appl. Microbiol. Biotechnol. 58 (2002) 679-682.

[46] C. Lodewyckx, S. Taghavi, M. Mergeay, J. Vangronsveld, H. Clijsters, D. van der Lelie, The effect of recombinant heavy metal resistant endophytic bacteria on heavy metal uptake by their host plant, Int. J. Phytoremed. 3 (2002) 173-187.

[47] M. Loganathan, V. Ramaswamy, Effect of blast (Bl) on IR 50 in late samba, Int. Rice Res. News 9 (1984) 6.

[48] J.M. Lynch, J.M. Whipps, Substrate flow in the rhizosphere, Plant Soil 129 (1990) 1-10.

[49] B.J. Macario, A.F. Sara, V.Z. Elsa, B. Stephane, P.C. Eduardo, Z. Edgar, Chemical characterization of root exudates from rice (Oryza sativa) and their effects on the chemotactic response of endophytic bacteria, Plant Soil 249 (2003) 271-277.

[50] J. Marmur, A procedure for the isolation of DNA from micro- organism, J. Mol. Biol. 3 (1961) 208-218.

[51] J. Marmur, P. Doty, Determination of the base composition of deoxyribonucleic acid from thermal denaturation temperature, J. Mol. Biol. 5 (1962) 109-118.

[52] N.K. Mukhopadhyay, N.K. Garrison, D.M. Hinton, C.W. Bacon, G.S. Khush, H.D. Peck, N. Data, Identification and characterization of bacterial endophytes of rice, Mycopathology 134 (1996) 151-159.

[53] R.H. Muller, S. Jorks, S. Kleinsteuber, W. Babel, Comamonas acidovorans strain MC1: a new isolate capable of degrading the chiral herbicides dichlorprop and mecoprop and the herbicides 2,4-D and MCPA, Microbiol. Res. 154 (1999) 241-246.

[54] R.H. Muller, S. Kleinsteuber, W. Babel, Physiological and genetic characteristics of two bacterial strains utilizing phenoxypropionate and phenoxyacetate herbicides, Microbiol. Res. 156 (2001) 121-131.

[55] D.J. O'Sullivan, F. O'Gara, Traits of fluorescent Pseudotnonas spp. involved in suppression of plant root pathogens, Microbiol. Rev. 56 (1992) 662-676.

[56] S. Pleban, L. Chernin, I. Chet, Chitinolytic activity of an endophytic strain of Bacillus cereus, Lett. Appl. Microbiol. 25 (1997) 284-288.

[57] S. Rangarajan, L.M. Saleenal, P. Vasudevan, S. Nair, Biological suppression of rice diseases by Pseudomonas spp. under saline soil conditions, Plant Soil 251 (2003) 73-82.

[58] N.P. Revsbech, O. Pedersen, W. Reichardt, A. Briones, Microsensor analysis of oxygen and pH in the rice rhizosphere under field and laboratory conditions, Biol. Fertil. Soils 29 (1999) 379- 385.

[59] N. Saitou, M. Nei, The neighbor-joining method: a new method for reconstructing phylogenetic trees, Mol. Biol. Evol. 4 (1987) 406- 425.

[60] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning:: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989.

[61] S. Schulz, W. Dong, U. Groth, A.M. Cook, Enantiomeric degradation of 2-(4-Sulfophenyl) Butyrate via 4-sulfocatechol in Delftia addovorans SPB1, Appl. Environ. Microbiol. 66 (2000) 1905- 1910.

[62] T. Shigematsu, K. Yumihara, Y. Ueda, S. Morimura, K. Kida, Purification and gene cloning of the oxygenase component of the terephthalate 1,2-dioxygenase system from Delftia tsuruhatensis strain T7, FEMS Microbiol. Lett. 220 (2003) 255-260.

[63] T. Shigematsu, K. Yumihara, Y. Ueda, M. Numaguchi, S. Morimura, K. Kida, Delftia tsumhatensis sp. nov., a terephthalate- assimilating bacterium isolated from activated sludge, Int. J. Syst. Evol. Microbiol. 53 (2003) 1479-1483.

[64] W. Song, H.L. Yang, X.L. Sun, Y.S. Wang, Y.D. Wang, Z.H. Chen, The rice endophytic diazotroph and PGPR, In: K.A. Malik, M.S. Mirza, J. Ladha (Eds.), Nitrogen fixateon with non-legumes, Kluwer Academic Publishers, Dordrecht, 1998, pp. 41-48.

[65] M. Sola, M. Endo, K. Nitta, H. Kawasaki, M. Tsuda, Characterization of a class II defective transposon carrying two haloacetate dehalogenase genes from Delftia addovorans plasmid pUO1, Appl. Environ. Microbiol. 68 (2002) 2307-2315.

[66] R.Y. Stanier, N.J. Palleronl, M. Doudoroff, Their aerobic Pseudomonads: a taxonomic study, J. Gen. Microbiol. 43 (1966) 159- 271.

[67] J.R. Stoltzfus, R. So, P.P. Malarvithi, J.K. Ladha, F.J. de Bruijn, Isolation of endophytic bacteria from rice and assessment of their potential for supplying rice with biologically fixed nitrogen, Plant Soil 194 (1997) 25-36.

[68] A.V. Sturz, B.R. Christie, J. Nowak, Bacterial endophytes: potential role in developing sustainable systems of crop production, Crit. Rev. Plant Sci. 19 (2000) 1-30.

[69] K. Sundiep, J. Tehara, D. Keasling, Gene cloning, purification, and characterization of a phosphodiesterase from Delftia addovorans, Appl. Environ. Microbiol. 69 (2003) 504-508.

[70] Z. Tan, T. Hurck, P. Gyaneshwar, J.K. Ladha, B. Reinhold- Hurek, Novel endophytes of rice form a taxonomically distinct subgroup of Serratia marcescens, Syst. Appl. Microbiol. 24 (2001) 245-251.

[71] K.V. Thara, Biological control of rice sheath blight by bacterial antagonists: mechanisms of disease suppression. Doctoral thesis, University of Madras. 1994, pp. 8-53.

[72] S. Toru, Y. Kazuyo, U. Yutaka, N. Masaki, M. Shigeru, K. Kenji, Delftia tsumhatensis sp. Nov., a terephthalate-assimilating bacterium isolated from activated sludge, Inter. J. Syste. Evol. Microbiol. 53 (2003) 1479-1483.

[73] A.M. van Buren, C. Andre, C.A. Ishimaru, Biological control of the bacterial ring rot pathogen by endophytic bacteria isolated form potato, Phytopathology 83 (1993) 1406.

[74] S.C. Verma, J.K. Ladha, A.K. Tripathi, Evaluation of plant growth promoting and colonization ability of endophytic diazotrophs from deep-water rice, J. Biotechnol. 91 (2001) 127-141.

[75] A. Wen, M. Fegan, C. Hayward, S. Chakraborty, L. Sly, Phylogenetic relationships among members of the Comamonadaceae, and description of Delftia acidovorans (den Dooren de Jong 1926 and Tamaoka et al. 1987) gen. nov., comb. Nov, Int. J. Syst. Bacteriol. 49 (1999) 567-576.

Jigang Han(a,b), Lei Sun(a,b), Xiuzhu Dong(c), Zhengqiu Cai(a), Xiaolu Sun(a), Hailian Yang(d), Yunshan Wang(e), Wei Song(a,*)

a College of Life Sciences, Capital Normal University, No. 105, Xisanhuan Beilu, Beijing 100037, PR China

b College of Life Sciences, Hebei University, Baoding, PR China

c Institute of Microbiology, Chinese Academy of Sciences, Beijing, PR China

d College of Biological Sciences, China Agricultural University, Beijing, PR China

e Institute of Process Engineering, Chinese Academyof Sciences, Beijing, PR China

Received 27 August 2004

* Corresponding author. Tel.: +86 1068902044; fax: +861068981191.

E-mail address: songwei@mail.cnu.edu.cn (W. Song).

Copyright Urban & Fischer Verlag Jan 2005


Source: Systematic and Applied Microbiology

More News in this Category


Related Articles



Rating: 3.5 / 5 (12 votes)
Rate this article:
1/52/53/54/55/5

User Comments (2)

2. Posted by Mitchel S. Taburaw on 03/11/2007, 21:05
Mitch a biology student, I have also the same methods as yours. I hope you can help me.. I also wanted see on how the methods and the results goes. can I also have a copies of them? mitch_stab2yahoo.com
1. Posted by Angealyn A. Gealon on 03/11/2007, 20:57
I am indeed interested with the study. The methods used are clear and understandable. If you dont mind, I would like to have a reprint or a copy of the article including the results for it is really a big help to me. The results of the study will provide me more knowlege. I am a Biology student in University of the Philippines and it just happen that my study has something to do with potential PGPR, yet they are still unidentified. Hopefully you can grant the request. email address: ladycrusiameek@yahoo.com

Comment on this article

Your Name
Text from the image
Comment
max 1200 chars
* All fields are required