• E-mail
• Print
• Comment
• Font Size
• Digg
• del.icio.us
• Discuss article

Novel Quorum-Sensing-Controlled Genes in Erwinia Carotovora Subsp. Carotovora: Identification of a Fungal Elicitor Homologue in a Soft- Rotting Bacterium

Posted on: Monday, 4 April 2005, 12:00 CDT

Seven new genes controlled by the quorum-sensing signal molecule N-(3-oxohexanoyl)-L-homoserine lactone (OHHL) have been identified in Erwinia carotovora subsp. carotovora. Using TnphoA as a mutagen, we enriched for mutants defective in proteins that could play a role in the interaction between E. carotovora subsp. carotovora and its plant hosts, and identified Nip^sub Ecc^ and its counterpart in E. carotovora subsp. atroseptica. These are members of a growing family of proteins related to Nep1 from Fusarium oxysporum which can induce necrotic responses in a variety of dicotyledonous plants. Nip^sub Ecc^ produced necrosis in tobacco, Nip^sub Eca^ affected potato stem rot, and both affected virulence in potato tubers. In E. carotovora subsp. carotovora, nip was shown to be subject to weak repression by the LuxR family regulator, EccR, and may be regulated by the negative global regulator RsmA.

Additional keywords: secretion, soft rot.

Quorum sensing is an important regulatory mechanism used to control a wide range of physiological processes in many bacterial species (Whitehead et al. 2001). In gram-negative bacteria, commonly used quorum-sensing systems rely upon a transcriptional regulator, similar to the LuxR protein of Vibrio fischeri, which is activated by a small signaling molecule, N-acyl homoserine lactone (or acyl HSL) (Eberhard et al. 1981). The former complexes with its cognate, acyl HSL, and regulates target gene expression by binding to specific sites in promoter regions. Expression of such genes generally is associated with high cell densities during the late exponential and early stationary phases of growth. Phenotypes regulated by acyl HSL-mediated quorum sensing include bioluminescence in V. fischeri. virulence factor production in Pseudontonas aeruginosa, and Ti plasmid conjugal transfer in Agmbacterhtm nimefacienx (Whitehead et al. 2001).

The phytopathogen Envinia camtovora subsp. carotovora (Ecc) causes soft rot disease in many crops worldwide (Perembelon 2002). The closely related bacterium E. carotovora subsp. atmxeptica (Ecu) also causes soft rot disease but has a host range limited to potato in temperate regions. The genome sequence of E. carotovora subsp. atroseptica SCRI1043 has been completed recently (Bell et al. 2004).

The main determinant of soft rot in these pathogens is the production of an array of exoenzymes, including pectate lyases, polygalacturonases, cellulases, and proteases (Barras et al. 1994; Thomson et al. 1999). Some E. carotovora subsp. carotovora strains also produce the antibiotic, 1-carbapen-2-em-3-carboxylic acid (carbapenem) (Parker et al. 1982). although the E. carotovora subsp. atmxcptica SCRl 1043 does not make this molecule. Production of both carbapenem and exoenzymes is regulated by quorum sensing during the latter stages of growth in E. carotovora subsp. carotovora (Bainton et al. 1992; Jones et al. 1993). The system is dependent on the acyl HSL, N-(3-oxohexanoyl)-L-homoserine lactone (OHHL), which is synthesized by the carl (expl or hsll) gene product (Chatterjee et al. 1995; Jones et al. 1993; Pirhonen et al. 1993; Swift et al. 1993). In carbapenem regulation, OHHL interacts with a LuxR homologue, designated CarR (McGowan et al. 1995; Welch et al. 2000) which, once activated by the acyl HSL, induces the transcription of the carbapenem synthesis genes. For the regulation of exoen/.ymes, it is believed that OHHL interacts with another, as yet unidentified LuxR homologue that then controls the relevant target genes. A second LuxR homologue, EccR (ExpR or RexR) has been identified in E. carotovora subsp. carotovora strains (Andersson et al. 2000; Rivet 1998) and appears to be involved in the repression of exoenzyme synthesis (Andersson et al. 2000). However, this effect may be strain dependent (Rivet 1998).

When this study was initiated, little was known about the extent of quorum-sensing control within a single microorganism. Most research was directed toward demonstrating the existence of quorum- sensing systems within an organism or the characterization of a particular phenotype or phenotypes. Recently, however, genome-wide screens for quorum-sensingcontrolled genes within some organisms have been performed using genome microarray and proteomic studies (Chen et al. 2003; Schuster et al. 2003; Wagner et al. 2003).

The aim of this study was to identify OHHL-regulated genes that encode proteins important in the soft rot Erwinia spp.plant interaction. For this purpose, we used the TnphoA transposon (Manoil and Beckwith 1985) to mutagenize a phosphatase (phoA)-deficient E. carotovora subsp. carotovora ATTn10 derivative, because active phoA fusions are created only in genes encoding proteins exported to the periplasm, or beyond, thus targeting potential virulence-related proteins (Hinton and Salmond 1987). The expression of the reporter gene fusion then was assessed in the presence and absence of OHHL. In this way, OHHL-responsive fusions were isolated and seven novel quorum-sensing-dependent genes were identified.

RESULTS

Isolation of OHHL-responsive genes.

A Pho^sup -^ derivative of E. carotovora subsp. camtovora ATTn10 (designated MS2) was isolated after chemical mutagenesis and screening of surviving colonies on the chromogenic substrate 5- bromo-4-chloro-3-indolyl-phosphate-p-toluidine (X-P). The MS2 mutant was prototrophic and not impaired in growth in Luria-Bertani broth (LB) (data not shown).

To enable screening for genes under quorum-sensing control, production of the signaling molecule OHHL first was abolished by transducing a carI::TnblaM mutation from strain JMJ7 (McGowan et al. 1995) into MS2 using the generalized transducing phage φKP (Toth et al. 1993). The resulting strain was designated MS20. Disruption of carI and resulting elimination of OHHL production were confirmed using the acyl HSL detector strain Chmmobacterium violaceum CV026 (McClean et al. 1997) and assays for the quorum- sensing-dependent production of exoenzymes and carbapenem (data not shown).

To identify OHHL-regulated genes, E. camtovora subsp. camtovora MS20 (pHCP2) was infected with a high titer (1 10^sup 11^ PFU ml^sup -1^) lysate of λTnphoA (Clement et al. 1982; Wilmes- Riesenberg and Wanner 1992) and transductant colonies selected on nutrient agar supplemented with kanamycin, OHHL. and X-P. Approximately 3% of transductants were blue, indicating a Pho^sup +^ phenotype. To differentiate between OHHL-responsive and nonresponsive gene fusions, blue colonies were rescreened on X-P in the presence and absence of OHHL and 43 of 3,626 (1.18%) displayed a positive response to the presence of OHHL.

Table 1. The novel quorum-sensing genes of Erwinia carotovora subsp. camtovora(a)

Fig. 1. Quorum-sensing regulation of the novel genes in Erwinia carolmom. Alkaline phosphatase activity was measured in each E. carolovora subsp. ramtm'imi mutant over 12 h of growth. Data represent phosphatase activity in a CarI^sup -^ strain (open bars), a CarI^sup +^ strain (black bars), and in a CarI^sup -^ strain with exogenously added N-(3-oxohexanoyl)-L-homoserine lactone (striped bars) at 1 g ml^sup -1^. Error bars represent one standard deviation from mean phosphatase activity. Data represent the average of three separate experiments.

To identity strains carrying TnphoA insertions in OHHL- repressible genes, MS20 was mutagenized again, with transductants selected on NA^sup Km^ and X-P without OHHL. Blue transductant colonies then were rescreened on NA^sup Km^, OHHL, and X-P, resulting in 4 of 1,550 (0.26%) showing reduced expression of Pho in the presence of OHHL compared with those in the absence of OHHL (data not shown).

Identification and analysis of quorum-sensing-controlled genes.

Following transduction of each transposon insertion into a clean genetic background (MS20), the presence of a single insertion in each strain was confirmed using Southern blotting with a transposon- specific probe (data not shown). All fusion strains produced wild- type levels of exoenzymes and carbapenem (data not shown), suggesting that transposon insertions were not located in genes encoding the major exoenzymes or carbapenem but in novel, quorum- sensing-controlled genes. The absence of any such insertions in major exoenzyme or carbapenem synthesis genes indicates that the mutagenesis did not saturate the entire E. carotovora subsp. camtovora genome.

To identify the location of each fusion, chromosomal DNA from each of the strains was digested with restriction enzymes to yield fragments of DNA containing the transposon insert. These fragments were ligated to pACYC184 and used to transform Escherichia coli DHSa. The primer TnSPrI. which is complementary to the right and left ISSO elements of TnphoA, then was used to sequence across the fusion junction between chromosomal DNA and transposon. In combination with Southern hybridization analysis (using probes designed to generated sequence), this revealed that the 43 OHHL- inducible fusion strains had been created by insertions at different locations within four different genes. These were designated oigl-4 for OHHL-inducible genes (Table I ). The four OHHL-repressible fusion strains were created by insertions in three different genes, and were \designated orgl-3 for OHHL-repressible genes (Table 1 ).

The generated sequence then was used to search the recently completed E. carotovora subsp. atmseptica genome sequence for similar sequences (Table I) (Bell et al. 2004). Where no similarity exists with E. carotovora subsp. atmseptica, translated sequences were used to screen the Gen Bank database using BLAST. The best of these hits are shown in Table I with a measure of this similarity.

Representatives of each of the seven classes of gene fusion were transduced into clean E. carotovora subsp. carotovora MS2 backgrounds using φ??. The expression of each gene in carl+ (MS2) and carl~ (MS20) backgrounds, with and without the addition of exogenous OHHL, was analyzed using PhoA assays (Brickman and Beckwith 1975). OHHL-inducible fusions oigl, oig2, and oig4 were found to be almost completely dependent on OHHL for their expression (Fig. 1; Table 1), mimicking the expression of genes encoding carbapenem and exoenzymes in E. carotovora subsp. carotovora (Bainton et al. 1992; Jones et al. 1993). The expression of oig3, however, was increased only by the presence of OHHL. The OHHL- repressible fusions orgl and org2 were downregulated by the presence of the OHHL, whereas expression of org3 was tightly repressed. In all cases, the time at which gene expression was induced during growth was unaffected (data not shown).

The effect of mutation of each of these genes on the virulence of E. carotovora subsp. carotovora in potato tubers also was investigated using an inoculum size of 106 cells. The amount of rotted tissue produced by each mutant was measured and the fusion strains with transposon insertions in the OHHL-inducible genes (with the exception of oig2, which is discussed further below) and org2 were found to be as virulent as the wild type under the conditions investigated. However, roles for orgl and org3 in virulence in planta were indicated (Fig. 2).

Nip, a protein similar to a type of fungal elicitor.

The product of oig2 shows similarity to a growing family of proteins related to Nepl, the elicitor of plant necrosis from Fusarium oxysporum (Bailey 1995; Pemberton and Salmond 2004). These have been identified in both phytopathogenic and saprophytic bacteria, oomycetes, and fungi (Fig. 3). Little is currently known about the function of these proteins or the reason for their conservation in such diverse organisms. However, nearly all members of the family, designated Nepl-like proteins (NLPs), contain conserved residues, including two cysteine residues and a central GHRHDWE motif. These all were found in Oig2. Based on its similarity to the NLPs. Oig2 was designated an E. carotovora subsp. carotovora necrosisinducing protein (Nip^sub Ecc^). A protein with 81% identity to Nip^sub Ecc^ also was identified in E. carotovora subsp. atmseptica SCRI1043 (Bell et al. 2004), and designated Nip^sub Eca^. The nip locus from this organism is shown in Figure 4A. Although nip could be formally operonic with the genes encoding proteins of unknown function that are found upstream from its start codon, it would form the last gene of this operon, Therefore, any mutation of nip^sub Eca^ will not have polar effects on the transcription of downstream genes.

With the possible exception of the homologue in Neurospora craasa. all NLPs are either secreted or predicted to he extracellular. The presence of an N-terminal signal sequence and its cleavage site in Nip^sub Ecc^ was confirmed by expression of the protein from the plasmid pNIP1 in Escherichia coli M15 pREP4. This plasmid was constructed by inserting Envinia cctrotovoni subsp. carotovora nip with its native ribosome-binding site into the vector pQE30 without the inclusion of the vector 6-His tag. Using N- terminal sequencing, Nip^sub Ecc^ isolated from the periplasinic fraction of Escherichia coli M15 pREP4 pNIP1 was found to have lost a 22-amino-acid signal sequence (Fig. 3).

Fig. 2. Potato tuber virulence assay for the Eivinia carotovora subsp. camtovora org mutants. Quorum-sensing mutants containing insertions in genes A, arg1, B, org2, and C, org3 were compared with a wild-type strain (MS2) for the ability to rot potato tubers. An inoculum size of 106 cells was used in each case. Assays also were performed for oig1, oig3, and oig4. The profiles generated by these mutants resembled that of org2. Error bars represent one standard deviation from the mean rot produced (in grams) from six potatoes.

Fig. 3. Alignment of the Nep1-like proteins (NLPs). Shading indicates sequence conservation with 100% (black), 80 to 99% (dark gray), and 60 to 79% (light gray) conservation shown. The sequences featured are from Erwinia carotovora subsp. carotovora (Ecc), E. camtovnra subsp. atroseptica (Eca), Fusarium oxysporum (Fo). Pythium aphanidermatum (Pa), Phytophthora infestons (Pi), P. parasitica (Pa), P. sojae (Ps), Neurospora crassa (Nc), Vibrio pommerensis sp. CH-291 (Vp). Bacillus haloilurans (Bh), and Streptomyces coelicolor (Sc). The signal sequence of Nip^sub Ecc^ is underlined.

Fig. 4. A, The nip locus of Erwinia camtovora subsp. atmseptica SCRI1043. The nip gene is shown (in white) together with the genes surrounding it (in gray). Genes are labelled with ECA gene numbers and predicted products as designated in the E. camtovora subsp. atmseptica SCRI1043 genome sequence (Bell et al. 2004). B, Production of necrosis in tobacco by heterologously-expressed Nip^sub Ecc^. Cell death in tobacco leaves induced by Nip^sub Ecc^. Panels were infiltrated with control strain Escherichia coli M15 pREP4 pQE30 or E. coli M15 pREP4 pNIPl as shown. Infiltrations were performed with sonicated cultures containing approximately 1 10^sup 9^ CFU ml^sup -1^. Picture taken after 24 h of incubation at 25C. The scale bar shown represents size in millimeters. This experiment was repeated on groups of six to eight plants on at least four separate occasions with the same result.

Nip^sub Ecc^ induces cell death in planta.

Other members of the NLP family, including those in F. oxysporum, Pythium aphanidermatum, and Phytophthora sojae, induce necrotic responses in a variety of dicotyledonous plants (Bailey 1995; Koch et al. 1998; Qutob et al. 2002). To test whether this was also true of Nip^sub Ecc^, E. coli M 15 pREP4 cultures containing pNIPl or pQE30 (vector without nip insertion) were suspended in 10 mM magnesium chloride, standardized to a concentration of 10^sup 9^ CFU ml^sup -1^, sonicated, and then infiltrated into opposing panels of Nicotiana uibacwn L. cv. Xanthi-nc leaves. In all leaves, cell death was observed only in panels infiltrated with sonicate from cells expressing NipElv (Fig. 4B). This cell death, initially visible as localized necrotic lesions, was seen at 9 to 10 h following infiltration. Within 48 h, the lesions had merged and tissue in the infiltrated leaf panel had collapsed. No response was observed in leaf sections infiltrated with sonicates of cells containing the vector only or the resuspension solution (10 mM magnesium chloride) controls.

To determine whether the site of Nip^sub Ecc^ application affects the production of leaf necrosis, spots of M15 pREP4 pNIPl were applied to the adaxial surface of the leaf. No cell death was observed, suggesting that Nip^sub Ecc^ is unable to cross the leaf cuticle and requires infiltration into the leaf to cause a response.

Fig. 5. Potato stem pathogenicity assay of Enviniu carotovora subsp. atroseptica (Eca). Pathogenicity assay showing A, wild-type E. carotovora subsp. atmseptira SCR11043 and B, PA1420 (nip[four dots above]Tn5Km^sup r^) on potato (cv. Estima) stems following inoculation with 10^sup 6^ cells/inoculation site and incubation at 22C for nine days. (C) Comparison of lesion development between E. cawtovora subsp. ulmseptica SCRl 1043 wild type and PA1420 at two inoculation concentrations (10^sup 2^ and 10^sup 6^ cells/ inoculation site). Least significant difference values were 1.6 and 12.6 for the low and high inocula, respectively (P < 0.05). Data presented shows average length of 12 replicates.

Nip^sub Eca^ functions in the development of stem rot in potato.

To obtain a nip mutant of Envinia carotovora subsp. atroseptica SCRl 1043, a pool of mutants generated by random mutagenesis using the transposon mTn5-#H.v/4-pgfp21 (Xi et al. 1999) was screened using polymerase chain reaction (PCR). Once identified, the in vitro growth rates of PA1420 (nip[four dots above]Tn5Km^sup r^) and the wild-type strain in LB were compared and found to be similar (data not shown). Potato plant stems then were inoculated with either 10^sup 6^ or 10^sup 2^ PA1420 CFU per inoculation site and compared with the equivalent level of the wild-type strain over nine days (Fig. 5). At both inoculum concentrations, lesion length was significantly reduced (P < 0.05) in stems inoculated with the mutant compared with the wild-type strain over the same period, with reductions of approximately 62 and 39% at inoculum concentrations of E. carotovora subsp. atroseptica at 10^sup 6^ and 10^sup 2^ CFU/ inoculation site, respecttively (Fig. 5). Multiple attempts were made to genetically complement the reduced-virulence phenotype using the nip gene cloned in trans, on various plasmids of different copy number. However, all derivatives of both the Nip mutant and the wild- type E. carotovora subsp. atroseptica host carrying the plasmid vectors, with or without the nip gene, showed seriously diminished virulence in potato stem assays, presumably because of a pronounced fitness cost of plasmid maintenance in the potato stem environment (data not shown). Thus, it proved impossible to assess complementation effects in these stem inoculation assays.

NipEcc is involved in soft rot production in potato tubers.

To determine whether Nip^sub Ecc^ or Nip^sub Eca^ is involved in the development of soft rot in potato, tuber assays were performed to compare the levels of tissue rot between the E\. carotovora suhsp. carotovora mutant CPlOOO (nip[four dots above]TnphoA) and MS2 (wild type), and between the E. carotovora subsp. atroseptica mutant PA1420 (nip[four dots above]Tn5Km^sup r^) and SCRI1043 (wild type). All LB-only controls were negative for soft rot.

Fig. 6. Potato tuber assay for Erwinia carotovora subsp. carotovora (Ecc) and E. carotovora subsp. atroseptica (Eca) nip mutant strains. Potato (cv. Estima) tuber assays were performed for both wild-type and nip disruption strains of Envinia carotovora subsp. carotovora and E. carotovora subsp. atmseptica using an inoculation size of 10^sup 2^ cells. A, Erwinia carotovora subsp. carotovora MS2 (wild type) and CPIO(X) (nip[four dots above]TnphoA) are compared. B, E. carotovora subsp. atroscpticu SCRI1043 (wild type) and E. carotovora subsp. atmseptica PA1420 (nip[four dots above]Tn5Km^sup r^) mutant. Error bars represent one standard error from the mean rotten tissue obtained from 16 potatoes in two separate experiments.

At an inoculum density of 10^sup 5^ CFU/inoculation site, there was no observable difference between the nip mutants and wild-type strains (data not shown). However, at 10^sup 2^ CFU/inoculation site, more tissue rot was generated by the wild-type strains than by their respective /n/j-mutants (Fig. 6). Student's / test showed a statistically significant difference (P < 0.05) between the E. carotovora subsp. carotovora mutant and its wild-type strain at 72 and 96 h. At each time point during the tuber assays, viable cell counts were performed but no differences between the numbers of wild- type or nip mutant cells were observed with either E. carotovora subsp. carotovora or atroseptica (data not shown). More importantly, unlike the problematic attempts at genetic complementation assays with the stem inoculation tests, provision of the wild-type nip allele in trans fully restored the Nip mutant to wild-type levels of rotting in tuber assays (Fig. 7).

The regulation of nip expression in E. carotovora subsp. carotovora.

To investigate the role of quorum sensing in nip expression, the impact of the two LuxR-like proteins in E. carotovora subsp. carotovora, EccR and CarR was investigated using the E. carotovora subsp. carotovora mutant CPlOOO (nip[four dots above]TnphoA). Mutations eccK[four dots above]TnphoA-'2 from E. carotovora subsp. carotovora A14 (S. Harris, unpublished data) and carR[four dots above]TnphoA-'2 from E. carotovora subsp. carotovora GB3 (Bosgelmez 1999) were transduced into CPlOOO and CPl016 (nip[four dots above]JnphoA and carI[four dots above]TnblaM) backgrounds using φKP. The levels of nip transcription then were monitored throughout growth using PhoA assays. The carR mutation had no impact on nip expression (data not shown). However, the disruption of eccR led to a slight increase (approximately 1.2-fold during early stationary phase) in nip transcription in the CPlOOO background (Fig. 8A). In CP1024 (nip[four dots above]Tn/;/i(M, carlr[four dots above]TnblaM, and eccR[four dots above]Ji\phoA-'2), the eccR mutation was found to have no impact on nip expression.

A link between the RsmA/r.v/fifi regulatory network and quorum- sensing control of genes encoding exoenzymes in E. carotovora subsp. carotovora has been reported previously (Chatterjee et al. 2002; Koiv and Mae 2001). To determine whether this network has any effect on nip expression, rsmB[four dots above]TnphoA-2 derivatives of CPlOOO and CP1016 were created by φKP-mediated transduction from E. carotovora subsp. carotovora C36 (S. Harris, unpublished data). By following nip expression throughout growth in Pho assays, a role for the rsm system in nip regulation was demonstrated. The mutation of rsniB, in both CarI^sup +^ and CarI^sup -^ strains, was found to reduce nip levels to those observed in CP1016 (Fig. 8B). The observed nip expression levels were reduced four- to fivefold compared with the wild-type during early stationary phase.

Fig. 7. Alloue complementation assay with the Envinia carolovom subsp. atmseplica Nip mutant. The tuber rotting assay was performed after 96 h, comparing the wild-type E. cumtovora subsp. atroseplica SCRI 1043 carrying the vector plasmid pCL1920; PA1420 carrying pCL)y20; and PA1420 carrying the plasmid with the wild-type nip allele in trans. pNIP20.

Mutation of rsmB, the antagonist of RsmA function, is likely to result in an increase in levels of the functional regulator. To determine whether the downregulation of nip expression in an rsmB mutant was due to repression, either directly or indirectly, by RsmA. strain CPlOOO was transformed with plasmids pSH58 (E. cawtovora subsp. carotovora rsmA in pCL1920) and pCL1920. The expression of nip throughout growth then was followed using PhoA activity (Fig. 8B). The possession of pCL1920 alone was found to cause a slight reduction in expression levels. However, possession of pSH58 resulted in a reduction to levels seen in an rsmB mutant. These data suggest that RsmA may have a repressive effect on Nip production in E. carotovora subsp. carotovora.

DISCUSSION

The aim of this study was to identify novel quorum-sensing- controlled proteins with a possible role in the soft rot Envinia spp.-plant interaction. TnphoA was used as the mutagen to enrich for mutants affected in possible periplasmic, transmembrane. outer membrane, and secreted proteins, while omitting cytoplasmic protein mutants. As a result, a much smaller subset of the total number of quorum-sensing-regulated genes in E. camtovora subsp. carotovora was identified compared with, for example, recent microarray analysis in Pseudomonas aeritginosa. where approximately 6% of the genome was shown to be under quorum-sensing control (Schuster et al. 2003). Of the quorum-sensing-controlled genes identified, however, a higher proportion of those with exported products were quorum-sensing induced rather than repressed.

Fig. 8. The regulation of nip transcription in Erwinia camrovora subsp. cawtovora. Alkaline phosphatase data showing levels of nip[four dots above]TnphoA expression in A, CPlOOO (nop[four dots above]TnphoA; all further mutants constructed in this genetic background). CP1016 (carI[four dots above]TnblaM), CP1022 (eccR[four dots above]TnphoA-2). and CP1024 (eccR[four dots above]Tnph0A-2. carl[four dots above]TnhlaM); and B, CPlOOO, CP1016, CP1027 (rsmB[four dots above]TnplioA-2). and CP1028 (rsmB[four dots above]TnphoA-2, carI[four dots above]Tnb/aM). Strains CPlOOO pSH58 (E. carotovora subsp. cawtovora rsinA in pCL1920) and CP1000 pCL1920 also are shown. Broken lines indicate bacterial growth while unbroken lines show alkaline phosphatase activity. Error bars represent + one standard deviation from the mean phosphatase activity. Data represents the average of three separate experiments.

Identification and possible functions of genes controlled by quorum sensing.

We identified seven novel quorum-sensing-regulated genes. Four were induced (designated oigl to 4) and three were repressed (orgl to 3) by the signaling molecule OHHL, highlighting the complexity of the quorum-sensing system in E. carotoroni subsp. camtovora. Three of the OHHL-induced genes were found to be almost completely dependent on the signaling molecule for their expression, as are genes that encode carbapenem and at least some of those encoding exoenzymes (Bainton et al. 1992; Jones et al. 1993). Expression of oig3. however, was increased by OHHL but not entirely dependent on it. Similar differences were seen in the OHHL-repressed genes, where the signal molecule tightly repressed org3 expression but only reduced expression of org 1 and org2.

Oig3 shares sequence similarity with the YoaJ protein, from Bacillus xiibtilis. which resembles PapC from Escltericliia colt (Millier et al. 1992). The latter is a membrane usher protein and part of the system responsible for folding and assembly of the P pilus in the outer membrane of uropathogenic E. coli (Thanassi et al. 1998). Like its putative E. coli counterpart, Oig3 is predicted to be periplasmic (PSORT prediction). Gene oig3 expression was uprcgulated by quorum sensing at low cell density, indicating that its protein may be important at low levels during noninfective growth as well as during infection (Fig. 1). This expression pattern is not surprising if, like PapC, Oig3 is involved in host cell attachment. Disruption of oig3 had no obvious effect on virulence in potato tubers, although it is possible that this crude assay circumvents the need for the Oig3 protein.

The identity of Oigl is unclear. PSORT predictions indicate that the protein is likely to be localized to the outer membrane. Gene oigl in Erwinia camtovora subsp. atmseptica has a lower average G+C content (44%) than the rest of the genome (50.9%) (Bell et al. 2004), suggesting possible acquisition from another organism by horizontal transfer.

Oig4 and Orgl show similarity to minor pectate Iyases (PeIL and PeIX, respectively) from E. chrvsanthemi (Park et al. 2000; Shevchik et al. 1999) and to proteins from E. camtovora subsp. atmseptica. Enzyme phenotypes were not apparent in such mutants during exoenzyme screens on agar plates, consistent with the absence of any visible reduction in virulence on potato tubers in /^-disrupt strains (data not shown). The dependence of oig4 on quorum sensing for transcription suggests that it may be required during a specific stage of infection. The different Pel isoenzymes in E. chrvsanthemi are thought to be sequentially expressed, possibly in response to changes in environmental pH (Nachin and Barras 2000). Oig4, like PeIL of E. cliiysantlieini, may have relatively low activity on polygalacturonate but may still play an important role at a specific stage of infection (Roy et al. 1999). The repression of orgl at high cell densities does not resemble the behavior of its E. chrysantliL'ini counterpart, pclX. This is induced by oxygen limitation and pectate catabo\lism products (Shevchik et al. 1999) which are more likely at high cell density and, therefore, high OHHL concentrations. Thus, Orgl in E, carotovora subsp. carotovora may have a role early in infection.

The gene product of org2 is similar to a nucleosidase from Vibrio vulnificus (Kim et al. 2003) and may play a role in nutrient scavenging. This would explain its repression during infection, where nutrients are more readily available, and also why its disruption has no obvious effect on virulence. Org3 shows sequence similarity to a putative huemagglutinin from Ralstonia solanacearum (Salanoubat et al. 2002). Its expression was completely repressed by quorum sensing, which is unusual because haemagglutinins are often important virulence factors. However, it may still have a role in virulence, possibly during initial attachment.

Biological properties of Nip, a homologue of a fungal elicitor of necrosis.

Oig2 (Nip^sub Ecc^) shows similarity to a family of proteins from fungi and bacteria, some of which induce plant cell necrosis (Bailey 1995: Fellbrich et al. 2002: Koch et ai. 1998). Based on similarity searches, a gene was identified in the E. carotovora subsp. atmseptica SCRl 1043 genome, the product of which shares 81% identity with Nip^sub Ecc^.

Although no precise biochemical function has yet been assigned to the NLP family, several members produce necrotic cell death in dicotyledons (Bailey 1995: Fellbrich et al. 2002; Koch et al. 1998). When expressed in Esclierichia coli, Nip^sub Ecc^ produced necrotic cell death in tobacco that resembled the hypersensitive response (HR). where programmed cell death occurs at the site of pathogen infection. However, it is not clear whether the necrosis observed with Nip^sub Ecc^. is a result of an HR-like response or a direct killing effect on plant cells, although data from other NLP responses suggests that it may be HR-type cell death (Fellbrich et al. 2002; Koch et al. 1998).

Despite producing plant cell necrosis, there is little data to suggest that the NLPs are vital for the production of plant disease. For example, the disruption of Nepl has no effect on the pathogenicity of F. oxysporum on Erythroxylum coca (Bailey et al. 2002). The role of NipEcc in Erwinia carotovora subsp. rflrotovora- produced tobacco leaf necrosis is not clear because the production of soft rot by the bacterium masks any necrotic effect. Spot inoculations to compare soft rot of a wild-type and nip mutant in tobacco did not demonstrate any clear difference (data not shown), therefore, the precise role for the protein in soft rot production by E. canttovora subsp. camtovora in tobacco is unclear.

Nip^sub Ecc^ and Nip^sub Ecc^ do, however, appear to function in the pathogenesis of Erwinia spp. on potato. A clear reduction in soft rot on potato tubers was observed in the later stages of infection (72 and 96 h postinfection) of an E. carotovora subsp. carotovora nip mutant. This effect was less obvious in E. carotovora subsp. atmseptica. In potato stem inoculations, a role for Nip^sub Ecc^, was observed. E. carotovora subsp. atroxeptica nip mutants showed a 62% reduction in rotting compared with the wild-type strain at an inoculation level of 10^sup 6^ cells, although the reason for this reduction in rotting is unclear. Both E. carotovora subsp. carotovora and atmseptica nip mutants show no alteration in exoenzyme production levels. It may be that the interaction between nip and plant cells promotes virulence either directly or via a protective function, possibly by interacting with components of the plant defense system. The latter hypothesis, however, seems unlikely because there was no obvious reduction in the survival of nip mutants from viable counts performed during potato tuber assays. A direct role in virulence seems more likely because, for example, the NLP homologue from Vibrio pommcrensi.i CH-29I possesses some hemolytic activity (Jores et al. 2003). However, the function of NLPs as virulence factors raises questions over their presence in apparently saprophytic organisms like Bacillus halodurans, Streptomyces coelicolor, and Neurospora crassa. NipEcc applied to external surfaces of tobacco leaves did not produce necrosis, suggesting that it is not able to cross the leaf cuticle and may thus require access to leaf intercellular spaces. This reflects the lifestyle of Erwinia spp., which only produce disease when inside plants. Bailey and associates (2002) observed that Nepl from F. oxysporum applied as a foliar spray had the greatest effect at midday and after a long dew period, when stomata were open and access to the interior of the leaf was optimal.

The presence of a classical secretion signal in Nip^sub Ecc^ was demonstrated using N-terminal sequencing of protein samples obtained from the periplasm of Escherichia coli strains expressing the protein, consistent with Nip^sub Ecc^ being transported across the inner membrane of Erwinia carotovora subsp. carotovora using the sec system. The secretion system used to traverse the outer membrane is not yet known.

Regulation of nip expression in soft rot Erwinia spp.

In E. carotovora subsp. carotovora, nip is under quorumsensing control, although the mechanism of this control is unclear. A fivefold reduction in nip levels was observed upon disruption of carl, the gene encoding OHHL synthase. However, because neither CarR nor EccR was responsible for regulation to this level (Fig. 8A), the chain of command between OHHL production and nip regulation in E. carotovora subsp. carotovora, as for exoenzyme genes, remains elusive.

To identify regulators that may play a role in nip regulation by quorum sensing, the effect of the Rsm system was investigated. This consists of the RNA-binding negative regulator RsmA and the untranslated rsmB mRNA, which is believed to act as an antagonist of the protein, using sequestration to neutralize its negative effects (Cui et al. 1995; Liu et al. 1998). It has been suggested that the effects of OHHL in E. carotovora subsp. carotovora may be achieved through the Rsm system (Chatterjee et al. 2002; Koiv and Mae 2001). RsmA previously has been described as a represser of genes in the interaction between an Erwinia sp. and its plant hosts (Mukherjee et al. 1996). RsmA also reduces the ability of E. amylovora to elicit a hypersensitive response (Mukherjee et al. 1996).

Table 2. Bacterial strains used in this investigation

We determined the role of rsmB in nip expression by measuring the activity of nip[four dots above]TnphoA in an rsmB^sup -^ mutant with either CarI^sup +^ or CarI^sup -^ backgrounds. In both strains, nip levels were the same as those observed in a car/-only disruption strain (approximately 4 to 5 reduction in expression compared with the wild type). The provision of rsinA in trans produced a similar effect.

Thus, RsmA may repress nip expression, concurring with the proposed model in which the absence of OHHL results in increased levels of RsmA by an unknown mechanism (Chatterjee et al. 2002; Koiv and Mae 2001). This suggests that in a Carl-background, RsmA levels are greatly increased while nip levels are reduced, as seen with exoenzyme levels in E. carotovora subsp. carotovora (Chatterjee et al. 2002). The same pattern is seen in an rsmB disruption strain where there is no antagonism of RsmA activity. The similar levels in the rsmB^sup -^ carI^sup -^ mutant may suggest that RsmA levels have reached a maximum and no further repression of nip is possible. These data agree with work by Mattinen and associates (M. Pirhonen, personal communication), who observed an increased production of Nip in E. carotovora subsp. carotovora SCC 3193 RpoS mutants which are known to have reduced RsmA levels. It is, however, unclear whether RsmA has a direct effect on nip transcript stability or whether this repression occurs through an intermediate step, such as the regulation of another transcriptional regulator.

In conclusion, we have successfully identified seven novel genes involved in quorum sensing in E. carotovora subsp. carotovora, and showed that at least one of these, nip, is involved in pathogenesis on potato and can induce necrosis in tobacco. Further work is required to understand their regulation and potential roles in the pathogenicity of this successful plant pathogen.

MATERIALS AND METHODS

Strains and media.

Strains used during this study are listed in Table 2. Unless stated otherwise, all cultures were grown in LB, M9 minimal medium (Sambrook et al. 1989), or on nutrient agar plates at 25 (E. carotovora subsp. atroseptica), 30 (E. carotovora subsp. camtovora and C. violacemn). and 37C (Escherichia coli). Where required, X-P and antibiotics were added to a final concentration of 50 g ml^sup - 1^ unless stated otherwise. For E. coli M15 pREP4 cultures, the pREP4 plasmid was maintained by addition of Km at 25 g ml^sup -1^. Exogenous OHHL (Paul Williams. Nottingham University, U.K.) was added to a final concentration of I g ml^sup -1^. During cloning steps, plasmids pACYC184 (New England Biolabs Ltd., Hitchin, U.K.) and pQE30 (Qiagen Ltd., Crawley, U.K.) were used as described. Plasmid pSH58, containing Erwinia camtovora subsp. camtovora rsmA in pCL1920, was made by S. Harris (unpublished data).

Chemical mutagenesis.

Chemical mutagenesis of E. camtovora subsp. camtovora ATTnIO was carried out using ethylmethane sulphonic acid (EMS) as described previously (Bainton et al. 1992). Colonies recovered after mutagenesis were analyzed for phosphatase activity on nutrient agar plates containing X-P. All phosphatase-negative candidates were analyzed for possible auxotrophy and their growth rates compared with that of the progenitor wild-type strain.

Transposon mutagenesis and generalized transduction.

Transposon mutagenesis of E. camtovora subsp. camtovora MS20 using λTnphoA (Wilmes-Riesenberg and Wanner 1992) was performed as described by Harris and associates (1998)\. Generalized transduction of E. camtovora subsp. camtovora and atmseptica strains using φKP and φM1, respectively, was as described by Toth and associates (1993, 1997).

Exoenzyme plate assays.

Pectate lyase and cellulase activities were detected using plate assays as described by Andro and associates (1984). Protease activity was determined using the plate assay of Hankin and Anagnostakis (1975). Samples (5 l) of an overnight culture of the microorganism to be tested were spotted onto the appropriate enzyme assay plate and incubated at 30C for 36 h.

Carbapenem plate assay.

Strains to be tested for carbapenem production were grown overnight in LB at 30C. Culture aliquots of 5 l were spotted onto a lawn of Escherichia coli ESS on a nutrient agar plate and incubated at 30C for 36 h before scoring inhibition halos due to the antibiotic.

DNA manipulation and sequence analysis.

Unless stated otherwise, all molecular biological techniques were performed according to Sambrook and associates (1989). Electroporations were performed as described by Dower and associates (1988) using a Bio-Rad Gene Puiser. DNA sequencing was earned out by Department of Biochemistry Sequencing Facility, Cambridge University. The primer TnSPR1 (CAGGA CGCTACTTGTG) was used to sequence across the transposongene-fusion junctions. Nucleotide sequence data were analyzed using the Genetics Computer Group software package (version 10.2 (Genetics Computer Group, Madison. WI. U.S.A.). The deduced primary protein sequence was compared with sequences within the GenBank/EMBL and SWISS-PROT data-bases using BLAST.

PCR amplification was performed using standard protocols, with primers NIPI (CGGAATTCATTGTAACTGCAAGG) and NIPlO (CGGAATTCGCTGTGTCGCCGCCTTC) used to amplify the oig2 (nip) gene from chromosomal DNA.

Alkaline phosphatase assay.

Samples were collected hourly throughout growth and sonicated using a Misonix sonicator before performing alkaline phosphatase assays as described by Brickman and Beckwith (1975). Optical density readings at 420 nm (OD^sub 420^) were measured using a Helios λ Unicam spectrophotometer, and readings expressed as alkaline phosphatase activity per milliliter of sample per minute of incubation time (at 37C) per optical density of the bacterial culture.

N-terminal sequencing.

E. coli M15 pREP4 pNIPl cultures were grown as described and separated into cytoplasmic, periplasmic, and supernatant fractions as described by Neu and Heppel (1965). Proteins from these fractions then were separated on a 159? sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel and transferred to Immobilon-P polyvinylidene diflouride membrane (Millipore Corporation, Bedford, MA, U.S.A.) using electroblotting (Sambrook et al. 1989). The band corresponding to Niplux from the periplasmic fraction then was sequenced at the Protein and Nucleic Acid Facility, Cambridge University.

Transposon mutagenesis of Erwinia carotovora subsp. atroseptica SCRI1043 and PCR screening.

Excliericliia coli S17-1 λpir, carrying the Tn5 cassette (mTn5-gusA-pfp21) (Xi et al. 1999) in the pUT vector (donor strain), and Envinia carotovora subsp. atmxepticd SCRI1043 (recipient strain) were grown to exponential phase in LB, with Km in the case of Escherichia coli. Donor and recipient strains were conjugated in a 2:1 ratio of donor to recipient for 6 h at 27C. Plates were washed with morpholineethanesulfonic acid (MES), and transconjugants were recovered on M9Km at 27C. In all. 4.608 transconjugants were selected and grown in 12 384-well microtiter plates (M9Km broth plus 47< glycerol). All were tested for Km resistance and sensitivity to umpicillin (Ap) to confirm insertion of the transposon and loss of pUT. Cells from each microtiter plate were transferred to M9Km agar and, following incubation at 27C for 48 h, DNA was extracted from each group of clones to give 12 pools of DNA for PCR screening.

Tn5 can insert in both orientations in the genome; therefore, each position of interest was searched with one of two possible "search primers" (both orientations) outside the transposon but in an area close to the gene of interest, together with the Tn5 primer" designed to anneal to one border of the Tn5 cassette. Initially, all 12 plate pools were screened and. where a PCR product of the expected size was generated, individual wells from that plate were rescreened to identify the mutant clone. PCR products were purified using the Wizard PCR Preps DNA Purification System (Promega Corp.. Madison, WI, U.S.A.) and sequenced in both directions using the ABI PRKSM BigDye terminator cycle sequencing ready reaction kit (v2.0; PE Biosystems, Foster City, CA, U.S.A.) to confirm the location of the transposon.

Leaf infiltration assay.

The 50-ml cultures of E. coli M15 pREP4 carrying pNIPl or pQE30 (control) were grown at 37C in LB (supplemented with Ap and Km) until an OD^sub 600^ of 0.5 was achieved. At this point, 1 mM isopropylthio-p-D-galactoside was added and the culture was incubated at 37C for a further 2 h. The culture then was centrifuged and the supernatant removed. The cellular pellet was resuspended in 50 ml of 10 mM magnesium chloride and sonicated until all cells had been disrupted.

Sonicated samples were injected into the leaf apoplast of 6to I0- week-old tobacco plants (Nicotiaiia tabacum L cv. Xanthinc) using a 10-ml syringe applied to the lower surface of the leaf as described in Klemcnt ( 1963), except that no needle was used. The progress of infiltration was monitored visually and injected leaf panels became translucent when air in the leaf spaces had been replaced completely with the solution. After approximately 30 min. leaves regained their normal appearance due to the solution being taken up by the leaf cells. The infiltrated tobacco plants were maintained in a greenhouse at 25C following injection and leaves were harvested at specified limes alter infiltration to monitor necrotic effects.

Tuber virulence assay.

The virulence of Erwinia camtovora subsp. camtovora strains was determined by local inoculation of intact Estima potato tubers as described by Walker and associates (1994). Starting inocula were 10^sup 5^ or 10^sup 2^ cells/inoculation site. Replica tubers were harvested at 24 h time points over a 96-h period and the level of potato tissue maceration determined by cutting the tubers in half and removing and weighing the necrotic tissue. Control experiments in which LB was injected into a potato also were carried out. Complementation tests on the Nip mutant of E. camtovora subsp. atmseptica using the wild-type nip allele with native promoter cloned in trans into plasmid pCLI920 were done as above and scored for rot after 96 h.

Viable counts were performed using 0.1 -g samples of rotted potato tissue resuspended in 1 ml of LB. Serial dilutions of this suspension then were performed using LB, spread onto LB agar plates, and incubated at the temperatures specified above.

Potato stem virulence assay.

Microplants of the potato cv. Estima (E. camtovora subsp. atmseptica susceptible) were obtained from a commercial source (Gentech, Dundee, U.K.), replanted in 15-cm pots containing compost, and grown to approximately 20 cm in height in a controlled glasshouse environment of 22C with a 16-h light regime. Bacterial strains were grown to log phase (overnight) in LB broth at 27C and cells were harvested by centrifugation at 4,000 g for 10 min, washed in phosphate-buffered saline (PBS) (pH 7.4), and resuspended in the same volume of PBS. Two dilutions (10^sup 8^ and 10^sup 4^ cells ml^sup -1^) were prepared in PBS from these suspensions, and potato plant stems were inoculated (under the second fully expanded leaf) with 10 l of bacterial suspension (equivalent to 10 and 10^sup 2^ cells/inoculation site) using a micropipette tip. Inoculation sites then were covered with parafilm to prevent desiccation. At least 12 replicate plants were used for each strain and at each inoculum. The inoculated plants were kept at 22C with a 16-h light regime and high humidity, and scored daily over a 9-day period for symptom development, which was recorded as length of rot (mm). Genstat for Windows (version 6.1.0.200; Genstat 6th edition, Lawes Agricultural Trust, Rothamsted, U.K.) was used for all statistical analyses (analysis of variance, P < 0.05).

ACKNOWLEDGMENTS

Wc would like to thank all the members of the Salmond Lab for helpful discussions, P. Williams for his generous donation of OHHL. and C. York for tobacco plants. C. L. Pemberton was supported by a Biotechnology and Biological Sciences Research Council (BBSRC) studentship. This work was supported by the BBSRC and the Scottish Executive Environment and Rural Affairs Department (seeRAD) and was carried out under DEFRA license PHL 177A/4627.

LITERATURE CITED

Andersson, R. A., Eriksson. A. R.. Heikinheimo. R., Mae, A., Pirhonen, M.. Koiv. V, Hyytiainen, H., Tuikkala. A., and Palva, E. T. 2000. Quorum sensing in the plant pathogen Enviniii carotomru subsp. carotavora: The role of expR (Ecc). MoI. Plant-Microbe Interact. 13:384-393.

Andro. T.. Chamhost, J. P., Kotoujansky. A., Cattaneo. J.. Bertheau, Y., Barras, F.. van Gijsegem, F.. and Coleno. A. 1984. Mutants of Erwinia chrvswtthemi defective in secretion of pectinase and cellulase. J. Bacteriol. 160:1199-1203.

Bailey, B. A. 1995. Purification of a protein from culture filtrates of Fusarium oxysporum that induces ethylene and necrosis in leaves of Erythmxylum coca. Phytopathology 85:1250-1255.

Bailey, B. A.. Apel-Birkhold, P. C., and Luster, D. G. 2002. Expression of NEPl by Fusarinm oxysporum f. sp. erythroxyli after gene replacement and overexpression using polyethylene glycol- mediated transformation. Phytopathology 92:833-841.

Bainton, N. J., Stead, P., Chhabra. S. R., Bycroft, B. W., Salmond, G. P. C., Stewart, G. S. A. B., and Williams. P. 1992. N- (3-Oxohexanoyl)-L-homoserine lactone regulates carbape\nem antibiotic production in Erwinia carotovom. Biochem. J. 288:997- 1004.

Barras, R. van Gijsegem. E, and Chatterjee, A. K. 1994. Extracellular enzymes and pathogenesis of soft-rot Erwinia. Annu. Rev. Phytopathol. 32:201-234.

Bell, K. S.. Sebaihia, M., Pritchard, L., Holden, M. T. G., Hyman, L. J., Holeva. M. C., Thomson, N. R., Bentley, S. D., Churcher, L. J. C., Mungall. K., Atkin, R., Bason, N., Brooks, K., Chillingworth, T., Clark, K., Doggett. J., Fraser. A., Hance. Z., Mauser, H.. Jagels, K., Moule, S., Norbertczak. H., Ormond. D., Price, C.. Quail. M. A., Sanders, M., Walker, D., Whitehead, S., Salmond, G. P. C., Birch, P. R. J., and Toth, I. K. 2004. Genome sequence of the enterobacterial phytopathogen Erwitihi carotovora subsp. airoseptica and characterization of virulence factors. Proc. Natl. Acad. Sci. U.S.A. 101:11105-11110.

Bosgelmez, G. 1999. Regulation of carbapenem antibiotic synthesis genes in Erwinia carotovom subspecies carotovora. Ph.D. thesis. University of Cambridge, UK.

Brickman. E., and Beckwith, J. 1975. Analysis of the regulation of Escherichia ctili alkaline phosphatase synthesis using deletions and Φ80 transducing phages. J. MoI. Biol. 96:307-316.

Chatterjee, A., Cui, Y., and Chatterjee, A. K. 2002. RsmA and the quorumsensing signal, N-[3-oxohexanoyl]-L-homoserine lactone, control the levels of rsmB RNA in Erwinia carotovora subsp. carotovora by affecting its stability. J. Bacteriol. 184:4089-95.

Chatterjee, A., Cui, Y. Y., Dumenyo, C. K., and Chatterjee, A. K. 1995. Inactivation of rsmA leads to overproduction of extracellular pectinases, cellulases and proteases in Erwinia carotovora subsp. carotovora in the absence of the starvation cell density signal, N- (3-oxohexanoyl)-L-homoserine lactone. Appl. Environ. Microbiol. 61:1959-1967.

Chen, H., Teplitski, M.. Robinson, J. B., Rolfe, B. G., and Bauer, W. D. 2003. Proteomic analysis of wild-type Sinorltizobiitin meliloti responses to N-acyl homoserine lactone quorum-sensing signals and the transition to stationary phase. J. Bacteriol. 185:5029-5036.

Clement. J. M., Perrin. D.. and Hedgpeth. J. 1982. Analysis of lambda receptor and beta-lactamase synthesis and export using cloned genes in a minicell system. MoI. Gen. Genet. 185:302-310.

Cui. Y, Chatterjee, A., Liu, Y., Dumenyo, C. K.. and Chatterjee, A. K. 1995. Identification of a global repressor gene, rsmA, of Erwinia carotovora subsp. carotovora that controls extracellular enzymes, N-(3-oxohexanoyl)-L-homoserine lactone, and pathogenicity in soft-rotting Erwinia spp. J. Bacteriol. 177:5108-5115.

Dower. W. J., Miller. J. F., and Ragsdale, C. W. 1988. High- efficiency transformation of Escherichia coli by high voltage electroporation. Nucleic Acids Res. 16:6127-6145.

Eberhard. A., Burlingame, A. L., Eberhard, C.. Kenyon, G. L., Nealson, K. H., and Oppenheimer, N. J. 1981. Structural identification of autoinducer of Photobacterium flscheri luciferase. Biochemistry 20:2444-2449.

Fellbrich, G., Romanski, A., Varet, A.. Blume. B.. Brunner, F., Engelhardt, S.. Felix, G., Kemmerling, B., Krzymowska. M.. and Nurnberger, T. 2002. NPPl. a Phytophthora-assocvMed trigger of plant defense in parsley andAmhiilopsis. Plant J. 32:375-390.

Hankin, L., and Anagnostakis, S. L. 1975. The use of solid media for the detection of enzyme production by fungi. Mycologia 67:597- 607.

Harris, S. J.. Shih. Y. L.. Bentley, S. D.. and Salmond. G. P. C. 1998. The hexA gene of Erwinia carotovora encodes a LysR homologue and regulates motility and the expression of multiple virulence determinants. MoI. Microbiol. 28:705-717.

Hinton, J. C.. and Salmond, G. P. C. 1987. Use of TnphoA to enrich for extracellular enzyme mutants of Erwinia carotovora subspecies carotovora. MoI. Microbiol. 1:381-6.

Jones, S.. Yu, B.. Bainton, N. J., Birdsall. M.. Bycroft, B. W., Chhabra, S. R.. Cox, A. J. R., Golby. P., Reeves. P. J.. Stephens. S., Winson, M. K., Salmond, G. P. C., Stewart, G., and Williams. P. 1993. The Lux autoinducer regulates the production of exoenzyme virulence determinants in Erwinia carotovora and Pseudomonas aeruginosa. EMBO (Eur, MoI. Biol. Organ.) J. 12:2477-2482.

Jores, J.. Appel. B., and Lewin, A. 2003. Cloning and molecular characterization of a unique hemolysin gene of Vibrio pommerensis sp. nov.: Development of a DNA probe for the detection of the hemolysin gene and its use in identification of related Vibrio spp. from the Baltic sea. FEMS (Fed. Eur. Microbiol. Soc.) Microbiol. Lett. 229:223-229.

Kim, Y. R., Lee. S. E., Kim, C. M., Kim. S. Y.. Shin. E. K., Shin. D. H., Chung, S. S., Choy. H. E.. Progulske-Fox, A.. Hillman. J. D., Handfield, M., and Rhee, J. H. 2003. Characterisation and pathogenic significance of Vibrio viilnificiis antigens preferentially expressed in septicemie patients. Infect. Immun. 71:5461-5471.

Klement. Z. 1963. Rapid detection of pathogenicity of phytopathogenic pseudomonads. Nature 199:299-300.

Koch. W., Wagner. C.. and Seitz.. H. U. 1998. Elicitor-induced cell death and phytoalexin synthesis in Duucu.i canna L. Planta 206:523-532.

Koiv, V.. and Mae. A. 2001. Quorum sensing controls the synthesis of virulence factors by modulating rxniA gene expression in Envinia carotovora subsp. camlovora. Mol. Genet. Genom. 265:287-292.

Liu, Y.. Cui. Y.. Mukherjee. A., and Chatterjee. A. K. 1998. Characterization of a novel RNA regulator of Erwinia camlovora subsp. carotovora that controls production of extracellular en/ymes and secondary metabolites. MoI. Microbiol. 29:219-234.

Manoil, C.. and Beckwith. J. 1985. TnphoA: A transposon probe for protein export signals. Proc. Natl. Acad. Sci. U.S.A. 82:8129-33.

McClean. K. H.. Winson. M. K.. Fish. L.. Taylor. A.. Chhabra. S. R., Camara, M.. Daykin. M.. Lamb, J. H.. Swift. S., Bycroft. B. W.. Stewart, G. S. A. B.. and Williams. P. 1997. Quorum sensing and Chminobacteriiim violaceum: Exploitation of violacein production and inhibition for the detection of N-acylhomoserine lactones. Microbiology 143:3703-3711.

McGowan. S., Sebaihia. M., Jones. S., Yu. B.. Bainton. N.. Chan. P. F., Bycroft. B.. Stewart. G. S. A. B., Williams. P.. and Salmond, G. P. C. 1995. Carbapenem antibiotic production in Erwinia camtovora is regulated by CurR, a homoloe of the Lux transcriptional activator. Microbiology 141:541-550.

Mukherjee. A.. Cui, Y. Y.. Liu, Y., Dumenyo. C. K., and Chatterjee. A. K. 1996. Global regulation in Envinia species by Envinia carotovora rsmA. a homologue of Escherichia coli c.irA: Repression of secondary metabolites, pathogenicity and hypersensitive reaction. Microbiology 142:427-434.

Muller. J.. Walter. F.. van Dijl. J. M.. and Bahnke. D. 1992. Suppression of the growth and export defects of an Esckcrichia coli secA (Ts) mutant by a gene cloned from Bacillus xuhtilis. MoI. Gen. Genet. 235:89-96.

Nachin. L.. and Barras, F. 2000. External pH: An environmental signal that helps to rationali/e pel gene duplication in Envinia chrvxantheini. MoI. Plant-Microbe Interact. 13:882-886.

Nelson, A. J.. Apel-Birkhold. P. C.. and Bailey. B. A. 1998. Sequence announcement. Plant MoI. Biol. 38:911-912.

Neu, H. C.. and Heppel. L. A. 1965. The release of enzymes from Escherichia coli osmotic shock and during the formation of spheroplasts. J. Biol. Chem. 240:3685-3692.

Park. S. R.. Kirn. M. K.. Kirn. J. O.. Bae. D. W.. Cho. S. J.. Cho. Y. U.. and Yun. H. D. 2000. Characterization of Envinia chn'.ianthemi PY35 eel and pel gene existing in tandem and rapid identification of their gene products. Biochem. Biophys. Res. Commun. 268:420-425.

Parker. W. L., Rathnum. M. L.. Wells. J. S.. Trejo. W. H.. Principe. P. A., and Sykes. R. B. 1982. SQ 27,860. a simple carbapenem produced by species of Serralia and Erwinia. J. Antibiot. 35:653-660.

Pemberton. C. L., and Salmond. G. P. C. 2004. The Nepl-like proteins-A growing family of microbial elicitors of plant necrosis. MoI. Plant Pathol. 5:353-359.

Perombelon. M. C. M. 2002. Potato diseases caused by soft rot erwinias: An overview of pathogenesis. Plant Pathol. 51:1-12.

Pirhonen. M.. Flego. D.. Heikinheimo. R., and Palva. E. T. 1993. A small diffusible signal molecule is responsible for the global control of virulence and exoen/.yme production In the plant pathogen Erwinia carotovora. EMBO (Eur. MoI. Biol. Organ.) J. 12:2467-2476.

Qutob. D., Kamoun. S.. and Gijzen. M. 2002. Expression of a Phytophthora sojae necrosis-inducing protein occurs during transition from biotrophy to necrotrophy. Plant J. 32:361-373.

Rivet, M. M. 1998. Investigation into the regulation of exoenzyme production in Erwinia carolovora subspecies camlovora. Ph.D. thesis. University of Warwick. U.K.

Roy. C. Kester. H.. Visser. J., Shevchik. V., Hugouvieux-Cotte- Pattat. N., Robert-Baudouy. J., and Benen. J. 1999. Modes of action of five different endopectate lyases from Envinia clirvxantheimi 3937. J. Bacteriol. 181:3705-3709.

Sulanoubat. M.. Genin. S.. Artiguenave, F.. Gouzy. J.. Mangenot. S., Arlat. M.. Billault, A.. Brottier. P.. Camus. J. C.. Cattolico. L., Chandler. M., Choisne. N.. Claudel-Renard, C.. Cunnac. S.. Demange. N., Gaspin. C., Lavie, M.. Moisan. A., Robert. C.. Saurin. W.. Schiex, T.. Siguier. P.. Thebault. P.. Whalen. M.. Wincker, P.. Levy. M.. Weissenbach. J.. and Boucher. C. A. 2002. Genome sequence of the plant pathogen Ralslonia solanacearum. Nature 415:497-502.

Sambrook. J.. Fritsch. E. F.. and Maniatis. T. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. NY. U.S.A.

Schuster, M.. Lostroh, C. P., Ogi. T.. and Greenberg. E. P. 2003. Identification, timing, and signal specificity of Pseiidomonas aeruninosu quorum-controlled genes: A transcripiome analysis. J. Bacteriol. 185:2066-2079.

Shevchik. V. E.. Kester. H. C.. Benen. J. A., Visser, J.. Robert- Baudouy. J., and Hugouvieux-Cotte-Pattat. N. 1999. Charucteri/ution of the exopolygalacturonate lyase PeIX of Enviniu rhrvxanthemi 3937. J. Bacteriol. 181:1652-1663.

Swift. S.. Winson. M. K.. Chan.P. F.. Bainton. N. J., Birdsall. M.. Reeves, P. J.. Rees, C. E. D., Chhabra, S. R.. Hill. P. J.. Throup. J. P.. Bycroft, B. W.. Salmond. G. P. C.. Williams. P.. and Stewart. G. 1993. A novel strategy for the isolation of Luxl homologues: Evidence for the widespread distribution of a LuxR:Luxl superfamily in enteric bacteria. MoI. Microbiol. 10:511-520.

Thanassi, D. G.. Saulino, E. T.. Lombarde). M. J.. Roth. R.. Hcuser. J.. and Hultgren. S. J. 1998. The PapC usher forms an oligomeric channel: Implications for pilus biogenesis across the outer membrane. Proc. Natl. Acad. Sci. U.S.A. 95:3146-3151.

Toth. I. K.. Perombelon. M.. and Salmond. G. P. C. 1993. Bacteriophage φKP mediated generalized transduction in Envinia camtovom subsp. camtovom. J. Gen. Microbiol. 139:2705-2709.

Toth I. K.. Mulholland. V.. Cooper. V. Bentley. S., Shih. Y. L., Perombelon, M. C. M.. and Salmond. G. P. C. 1997. Generalised transduction in the blackleg pathogen Erwinia camtovom subsp. atroseplica by bacteriophage φM1. Microbiology 143:2433-2438.

Thomson. N. R.. Thomas, J. D., and Salmond. G. P. C. 1999. Virulence determinants in the bacterial phytopathogen Envinia. Methods Microbiol. 29:347-426.

Wagner, V. E.. Bushnell. D.. Passador. L.. Brooks. A. L. and Iglewski. B. H. 2003. Microarray analysis of Pseiuloinomis aeruginosa quorumsensing regulons: Effects of growth phase and environment. J. Bacteriol. 185:2080-2095.

Walker. D.. Reeves, P. J.. and Salmond. G. P. C. 1994. The major secreted cellulase. CeIV. of Envinia carotovora subsp. camtovom is an important virulence factor. MoI. Plant-Microbe Interact. 7:425- 431.

Welch. M.. Todd. D. E.. Whitchcad. N. A., McGowan, S. J.. Bycroft, B. W., and Salmond. G. P. C. 2000. N-Acyl homoserine lactone binding to the CarR receptor determines quorum-sensing specificity in Envinia. EMBO (Eur. Mol. Biol. Organ.) J. 19:631- 641.

Whitehead. N. A.. Barnard. A. M. L., Slater, H., Simpson. N. J. L. S., and Salmond. G. P. C. 2001. Quorum-sensing in Gram-negative bacteria. FEMS (Fed. Eur. Microbiol. Soc.) Microbiol. Rev. 25:365- 404.

Wilmes-Riesenberg. M. R.. and Wanner. B. L. 1992. TnphoA and TnphoA' elements for making and switching fusions for study of transcription, translation, and cell surface localization. J. Bacteriol. 174:4558-4575.

Xi. C.. Lambrecht. M.. Vanderleyden, J.. and Michiels. J. 1999. Bi-functional gfp- and gusA-containing mini-Tn5 transposon derivatives for combined gene expression and bacterial localization studies. J. Microbiol. Methods 35:85-92.

AUTHOR-RECOMMENDED INTERNET RESOURCES

European Bioinformatics Institute website: ww.ebi.ac.uk

PSORT server: psort.nibb.ac.jp

Scottish Crop Research Institute Envinia genome sequence webpage: www.scri.sari.ac.uk/erwinia

The Wellcome Trust Sanger Institute website: www.sanger.ac.uk

C. L. Pemberton,1 N. A. Whitehead,1 M. Sebaihia,1 K. S. Bell,3 L. J. Hyman,3 S. J. Harris,1 A. J. Matlin,1 N. D. Robson,1 P. R. J. Birch,3 J. P. Carr,2 I. K.Toth,3 and G. P. C. Salmond1

1 Department of Biochemistry and 2 Department of Plant Sciences, Tennis Court Road, Cambridge, CB2 1QW, U.K.; 3 Scottish Crop Research Institute, Invergowrie, Dundee, DD2 5DA, U.K.

Submitted 12 April 2004. Accepted 22 November 2004.

Corresponding author: G. P. C. Salmond; E-mail: gpcs@mole.bio.cam.ac.uk

Copyright American Phytopathological Society Apr 2005

Source: Molecular Plant-Microbe Interactions; MPMI

More News in this Category