Use of Proximity Ligation to Screen for Inhibitors of Interactions Between Vascular Endothelial Growth Factor A and Its Receptors
By Gustafsdottir, Sigrun M Wennstrom, Stefan; Fredriksson, Simon; Schallmeiner, Edith; Hamilton, Andrew D; Sebti, Said M; Landegren, Ulf
BACKGROUND: Improved methods are required to screen drug candidates for their influences on protein interactions. There is also a compelling need for miniaturization of screening assays, with attendant reductions in reagent consumption and assay costs. METHODS: We used sensitive, miniaturized proximity ligation assays (PLAs) to monitor binding of vascular endothelial growth factor A (VEGF-A) to 2 of its receptors, VEGFR-1 and VEGFR-2. We measured the effects of proteins and low molecular weight compounds capable of disrupting these interactions and compared the results with those obtained by immunoblot analysis. We analyzed 6 different inhibitors: a DNA aptamer, a mixed DNA/RNA aptamer, a monoclonal VEGF-A neutralizing antibody, a monoclonal antibody directed against VEGFR- 2, a recombinant competitive protein, and a low molecular weight synthetic molecule.
RESULTS: The PLAs were successful for monitoring the formation and inhibition of VEGF-A-receptor complexes, and the results correlated well with those obtained by measuring receptor phosphorylation. The total PLA time is just 3 hours, with minimal manual work and reagent additions. The method allows evaluation of the apparent affinity [half-maximal inhibitory concentration (IC^sub 50^)] from a dose-response curve.
CONCLUSIONS: The PLA may offer significant advantages over conventional methods for screening the interactions of ligands with their receptors. The assay may prove useful for parallel analyses of large numbers of samples in the screening of inhibitor libraries for promising agents. The technique provides dose-response curves, allowing IC^sub 50^ values to be calculated.
(c) 2008 American Association for Clinical Chemistry
Many biological processes are mediated by interactions between proteins. Accordingly, investigations of these binding reactions are of growing importance and can assist in the development of drugs that target specific interacting proteins. For example, the extensive growth of blood vessels that occurs during cancer (1), rheumatoid diseases, and ocular diseases (2, 3) requires a protein- signaling cascade. Disruption of this cascade causes tumor hypoxia, for example, and hence facilitates treatment. A number of antiangiogenic drugs are undergoing clinical trials at the National Cancer Institute (4). Vascular endothelial growth factor A (VEGF- A)5 (165-amino acid residue form) signaling is a very promising target for antiangiogenic cancer therapies, because this protein circulates in the blood and acts directly on endothelial cells as a powerful regulator of tumor angiogenesis (5-7). VEGF-A binds to 2 related receptor tyrosine kinases, VEGF receptor 1 [VEGFR-1 (Flt- 1)] and VEGFR-2 (KDR). VEGFR-2 induces proliferation, survival, and vascular permeability, whereas VEGFR-1 may trap VEGF-A, preventing it from signaling (8).
Examples of bioassays that measure the growth of blood vessels and the effects of specific inhibitors include in vitro assays of endothelial cell migration (9) and proliferation (10), and the in vivo cornea pocket assay for observing vascularization of the normally avascular cornea (11).
Automated in vitro high-throughput screening techniques are required to evaluate large libraries of drug candidates, such as those created via combinatorial chemical synthesis. There is a compelling need for miniaturized screening assays that reduce reagent consumption and lower assay costs. Assay miniaturization in turn necessitates increased sensitivity because the assay volumes and numbers of molecules are reduced. Homogeneous assays that involve only sequential additions of reagents and no separation steps are desirable for high-throughput screening of drug candidates (12). The scintillation proximity assay is a commonly used homogeneous-phase technique for monitoring ligand binding to immobilized receptors (13). The method is based on the binding of a radioactive ligand to receptors immobilized on the surface of microbeads in close proximity to the scintillants. The radiation produced by the bound ligand leads to scintillant excitation, which is observable as light emission.
Fig. 1, Schematic overview of the PLA for measuring inhibition of protein interaction.
(A), When the target protein (VEGF-A, pink ovals) is bound by a pair of proximity probes, the free ends of the oligonucleotide extensions of the affinity probes are brought into proximity. The added connecting oligonucleotide binds to both DNA fragments and assembles their 5′ and 3′ ends, whereupon the 2 strands are ligated by DNA ligase. The produced product is amplified and detected by real-time PCR. (B), The target protein VEGF-A is incubated with a soluble VEGFR (blue rectangles). On binding of VEGF-A to the receptor, the latter dimerizes, and VEGF-A becomes inaccessible to the proximity probes, producing a loss of signal in the PLA tests. (C), VEGF-A is incubated with the soluble VEGFR in the presence of an inhibitor (green square) that competes with VEGF-A for receptor binding. Therefore, VEGF-A remains free and accessible to the proximity probes, generating a signal in the PLA tests. (D), When art inhibitor binds directly to the VEGF-A protein, the proximity probes are displaced, producing a loss of PCR signal.
The proximity ligation assay (PLA) is a recently developed technique based on detecting proteins with the help of specific probes that contain conjugated DNA. The proteins are thereby reported as DNA signatures that can easily be detected and quantified by the PCR. Upon the coincident binding of pairs of affinity probes to a target protein, the attached DNA strands are brought in proximity to be joined by ligation, giving rise to specific amplifiable DNA strands. PLA permits highly specific and sensitive solution-phase detection of proteins in 1-[mu]L samples. This approach has been useful for detecting cytokines, growth factors, and infectious agents in complex biological samples (14- 17), and several target molecules can be investigated in parallel in the same reaction (18).
Fig. 2. Analysis of interaction of VEGF-A with VEGFR-1 and VEGFR- 2.
(A), Interactions of 1 pmol/L VEGF-A with various concentrations of VEGFR-1 (white columns) and VEGFR-2 (black columns). The signals from 1 pmol/L VEGF-A alone and the background (PBS) are shown in gray (shadowed). The results are presented as a percentage of the maximal signal, which is generated by VEGF-A only (y axis). The molar concentrations of the receptors are shown along the x axis. Column heights represent mean values, and error bars indicate the ranges of triplicate measurements. The data shown are representative results of 3 separate experiments. (B), VEGF-A induces VEGFR-2 phosphorylation in PAE cells. Serum-starved PAE cells were stimulated with the indicated concentrations of VEGF-A for 10 min. Cell lysates were immunoprecipitated with VEGFR-2 antibodies and resolved by SDS-PAGE, and phosphorylated VEGFR-2 was visualized by immunoblotting with phosphotyrosine antibodies (upper panel). Lysates were also analyzed for VEGFR-2 phosphorylation (middle panel) and for equal loading (lower panel) with phosphotyrosine and beta-actin antibodies, respectively. Ip, immunoprecipitation; alphaVEGFR-2, VEGFR-2 antibody; alphaPY, phosphotyrosine antibody; alphabeta-actin, beta-actin antibody.
We describe the use of PLA to monitor VEGF-A binding to 2 of its receptors, VEGFR-1 and VEGFR-2, and we demonstrate the applicability of this assay for the sensitive detection of the effects of agents that disrupt these interactions. We analyzed 6 different inhibitors: a DNA aptamer, a mixed DNA/RNA aptamer, a monoclonal VEGF-A neutralizing antibody, a monoclonal antibody directed against VEGFR- 2, a recombinant competitive protein, and a low molecular weight synthetic molecule.
Materials and Methods
PROXIMITY LIGATION REAGENTS AND INHIBITORS
Recombinant human VEGF-A165 protein, soluble receptors VEGFR-1 and VEGFR-2, neutralizing VEGF-A monoclonal antibody, a recombinant competitive protein (placental growth factor), and biotinylated affinity-purified polyclonal VEGF-A antibodies were all purchased from R&D Systems. A neutralizing VEGFR-2 monoclonal antibody (C27) was generously provided by ImClone Systems (New York, NY).
The VEGF-A aptamer t22-OMe was purchased from Interactiva (ThermoHybaid). The aptamer sequence is a mixed DNA/RNA oligonucleotide sequence with modified 2′ RNA residues: 5′-P-GC AACGATGA”OCGgUaGGAAGAAUUGGAAGCGC” AACATCACCC-3′. The nucleotides between the quotation marks are RNA. All of the U and C residues in this part of the sequence had a 2′ fluoro group, and all As and Gs are 2′ O-methyl-modified except for the nucleotides represented by lowercase letters, which indicate the normal 2′-OH RNA.
The platelet-derived growth factor DNA aptamer 41t (5′- TACTCAGGGCACTGCAAGCAATTGTGGT CCCAATGGGCTGAGTA-3′) was purchased from Interactiva (ThermoHybaid).
PROXIMITY PROBES
Proximity probes with free 3′ or 5′ ends were created by conjugating thiol-modified oligonucleotides to maleimide- derivatized streptavidin (STV). The conjugates were subsequently reacted with biotinylated VEGF-A antibodies as described elsewhere (14). The oligonucleotide sequences were as follows: 5′freeSTV, 5′- PTCGTGTCTAAAGTCCGTTACCTTGATTCCCC TAACCCTCTTGAAAAATTCGGCATCGGTGA-3′; 3′STV, 5′-CGCATCGCCCTTGGACTACGACTGAC GAACCGCTTTGCCTGACTGATCGCTAAATCGTG3′ OH. PROXIMITY LIGATION ANALYSIS OF VEGF-A INHIBITION
We incubated 1 [mu]L of 1 pmoVL VEGF-A with 1 [mu]L of inhibitor together with 50 pmol/L 5′ freeSTV and 3′freeSTV in a total volume of 6 [mu]L at 37 [degrees]C for 1 h. We then added 45 [mu]L of a combined mix for ligation and amplification [final concentrations: 50 mmol/L KCl, 10 mmol/L Tris-HCl, pH 8.3, 3.15 mmol/L MgCl^sub 2^, 0.4 Weiss units of T^sub 4^ DNA ligase (Fermentas), 400 nmol/L connector oligonucleotide (5'-TACTTAGACACGA CACGATTTAGTTT-3'; biomers.net), 80 [mu]mol/L ATP, 200 [mu]mol/L of each deoxynucleoside triphosphate, 100 nmol/L of each primer (forward, 5′- CATCGCCCT TGGACTACGA-3′; reverse, 5′-GGGAATCAAGGTA ACGGACTTTAG-3′; biomers.net), 100 nmol/L TaqMan(R) MGB probe (5′-FAM- TGACGAACCGCTTTGCCTG ACTGA-MGBNFQ-3′; Applied Biosystems), and 1.5 U Platinum Taq DNA polymerase (Invitrogen)]. After the addition of the combined mix, the tubes were sealed with optical PCR lids (Applied Biosystems) and transferred to a real-time PCR instrument, either Stratagene’s MX 3000P or the ABI7000 from Applied Biosystems. The reaction conditions consisted of an initial incubation at 95 [degrees]C for 2 min, followed by 45 cycles of 95 [degrees]C for 15 s and 60 [degrees]C for 1 min. The results were presented either as threshold cycle (C^sub T^) values or as signal-to-noise ratios (the number of ligations of proximity probe pairs that occurred in the sample divided by the number of ligations in the negative control).
Fig. 3. Inhibition of VEGF-A by a VEGF aptamer and a neutralizing VEGF monoclonal antibody (mAb).
(A), Inhibition of VEGF-A binding to VEGFR-2 by the indicated concentrations of a VEGF-A aptamer (gray columns) and by neutralizing VEGF-A mAb (black columns). An aptamer against platelet- derived growth factor (PDGF) (white columns) was used as a specificity control. The results are presented as a percentage of the maximal signal, which is generated by 1 pmol/L VEGF-A (y axis). Inhibitor concentrations are shown along the x axis. Column heights represent mean values, and error bars indicate the range of triplicate measurements. The data shown are representative results from 3 separate experiments. (B), Panels on the left side show inhibition of VEGF-A-induced VEGFR-2 phosphorylation by a VEGF-A aptamer. Starved PAE cells were ‘ preincubated for 5 min with the indicated concentrations of VEGF-A aptamer before being stimulated with 10 [mu]g/L VEGF-A for 10 min. Analysis of VEGFR-2 phosphorylation was performed as described in Fig. 2B. Panels on the right side show VEGFR-2 phosphoryfation in response to neutralizing VEGF-A antibodies. Starved PAE cells were preincubated for 5 min with the indicated concentrations of neutralizing VEGF-A antibodies before being stimulated with 30 [mu]g/L VEGF-A for 10 min. Analysis of VEGFR-2 phosphorylation was performed as described in Fig. 2B, Ip, imrnunoprecipitation; betaVEGFR-2, VEGFR-2 antibody; alphaPY, phosphotyrosine antibody; alphabeta-actin, beta-actin antibody.
PROXIMITY LIGATION ANALVSIS OF VEGFR-2 INHIBITION
We preincubated 1 [mu]L of 1 nmol/L VEGFR-2 with 1 [mu]L of inhibitor for 30 min at 37 [degrees]C. We then added 1 [mu]L of 1 pmol/L VEGF-A together with 50 pmol/L of 5′freeSTV and 3′freeSTV to the first incubation (6 [mu]L total) and incubated further for l h at 37 [degrees]C. The ligation and PCR steps were carried out as outlined above.
Fig. 4. Inhibition of VEGFR-2 by a VEGFR-2 monoclonal antibody (C27).
(A), Inhibitory effect of an anth-VEGFR-2 monoclonal antibody (C27) on the binding of VEGF-A to VEGFR-2 (rec) (black columns); and the absence of such an effect in the control sample with increasing concentrations of piacental growth factor (PIGF) (white columns). Column heights represent mean values, and error bars indicate the range of triplicate measurements. The data shown are representative results from 3 separate experiments. (B), Panels on the left side show that PIGF does not affect VEGFR-2 phosphorylation induced by VEGF-A. Starved PAE cells were preincubated for 5 min with the indicated concentrations of PIGFT and then stimulated with 30 [mu]g/ L VEGF-A for 10 min. VEGFR-2 phosphorylation was analyzed as described in Fig. 2B. Panels on the right side show that anti-VEGFR- 2 monoclonal antibody (C27) inhibits VEGF-A-induced phosphorylation of VEGFR-2. Assay conditions are as in Fig. 3B. Ip, immunoprecipitation; alphaVEGFR-2; VEGFR-2 antibody; alphaPY, phosphotyrosine antibody;. alphabeta-actin, beta-actin antibody.
CELL CULTURE AND IMMUNOBLOTTING
Porcine aortic endothelial cells that stably produce VEGFR-2 (PAE/ KDR.11) were cultured in Ham’s F-12 medium (Invitrogen) containing 100 mL/L fetal calf serum (Invitrogen). For analysis of VEGFR-2 phosphorylation, we seeded 0.75 x 10^sup 5^ cells per 6-cm dish. After a 24-h incubation, we serum-starved the cells for an additional 24 h in Ham’s F-12 medium containing 1 mL/L fetal calf serum and then stimulated them with VEGF-A (PeproTech) in the absence or presence of inhibitors of VEGF-A/VEGFR-2 function. The cells were lysed in 0.5 mL lysis buffer (50 mmol/L HEPES, pH 7.5,100 mmol/L NaCl, 1 mmol/L EGTA, 100 [mu]mol/L Na^sub 3^VO^sub 4^, 10 mg/ L aprotinin, 0.1 mmol/L phenylmethylsulfonyl fluoride, 1 mmol/L dithiothreitol, and 10 mL/L Triton X-100). Cleared lysates were immunoprecipitated with VEGFR-2 antibodies (R&D Systems). Immunoprecipitates and 30 [mu]L of cell lysates (approximately 25 [mu]g) were separated by SDS-PAGE and electrophoretically transferred onto Hybond-C Extra membranes (GE Healthcare/Amersham Biosciences). The membranes were then blocked in PBS (containing 137 mmol/L NaCl, 2.7 mmol/L KCl, 10 mmol/L Na^sub 2^HPO^sub 4^, and 2 mmol/L KH^sub 2^PO^sub 4^) containing 30 g/L bovine serum albumin (Roche). Phosphorylation of VEGFR-2 was visualized with PY20 phosphotyrosine antibodies (UBI), and equal loading of lysates was confirmed with beta-actin antibodies (Santa Cruz Biotechnology). Finally, we incubated the membranes with the appropriate secondary antibodies conjugated to horseradish peroxidase (GE Healthcare/ Amersham Biosciences) and visualized immune reactivity with an enhanced chemiluminescence detection system (ECL; GE Healthcare/ Amersham Biosciences).
Fig. 5. Inhibition of VEGF-A by a low molecular weight inhibitor, GFA-116.
(A), Inhibition of VEGF-A binding to VEGFR-2 by the low molecular weight inhibitor GFA-116. The results are presented as a percentage of the maximal signal generated by 1 pmol/L VEGF-A alone (left gray column). Shown on the x axis are I results with VEGFR-2 (rec) in the reaction without inhibitor (right gray column) and with several GFA- 116 concentrations (black columns). Column heights represent mean values, and error bars indicate the range of triplicate measurements. The data shown are representative results from 3 separate experiments. (B), The GFA-116 molecule inhibits VEGF-A- induced VEGFR-2 phosphorylation. Assay conditions are as in Fig. 3B. Ip, immunoprecipitation; alphaVEGFR-2; VEGFR-2 antibody; alphaPY, phosphotyrosine antibody; alphabeta-actin, beta-actin antibody.
DATA ANALYSIS
The proximity ligation reactions were performed in triplicate. The results presented in the figures are mean percentages of the maximum signal generated by VEGF-A alone. The signals were calculated as the numbers of ligations of the proximity probe pairs in the samples. The immunoblots represent the results of at least 2 independent experiments. The half-maximal inhibitory concentration (IC^sub 50^) (i.e., the inhibitor concentration required for 50% inhibition of the target) was estimated for all of the inhibitors.
Results
We have used PLA to investigate the effects of 6 inhibitors on the binding of VEGF-A to its receptors, VEGFR-1 and VEGFR-2, and we have compared these results with those obtained by immunoprecipitation of VEGFR-2 from VEGFR-2- overproducing cells treated with VEGF-A and the same inhibitors.
Fig. 1 presents an overview of how the study was performed and how the results were calculated. The signal generated by the detection of VEGF-A (Fig. 1A) is lost when VEGF-A is incubated with a soluble VEGFR (Fig. 1B), because the protein is no longer accessible to the proximity-probe conjugates after binding and dimerization of the receptors. In contrast, VEGF-A remains free and available for detection by proximity probes when VEGF-A is incubated with the receptor in the presence of an inhibitor that competes for binding to the receptor or that hinders its dimerization (Fig. 1C). Finally, in the presence of an inhibitor that binds directly to VEGF- A, the protein becomes inaccessible for the proximity probes, leading to a loss in signal (Fig. 1D).
First, we analyzed the binding of 1 pmol/L VEGF-A to VEGFR-I and to VEGFR-2 (Fig. 2A). VEGF-A showed substantially stronger binding to VEGFR-1 than to VEGFR-2. This result is in accordance with the results of Shibuya et al. (19), who reported the affinity of VEGF-A for VEGFR-1 to be quite high (K^sub d^ = 10 pmol/L), compared with VEGFR-2 (K^sub d^ = 100 pmol/L) (20). A dose-response curve for ligand-induced phosphorylation of VEGFR-2 was obtained for a range of VEGF-A concentrations (Fig. 2B). On the basis of these results, we subsequently used 30 nmol/L VEGF-A for receptor stimulation in analyses of the effects of various inhibitory agents (with the exception of the VEGF-A aptamer, for which we had to use a concentration of 10 nmol/L to detect a clear effect of this inhibitor).
We investigated the effects of 2 inhibitors that bind directly to VEGF-A; the VEGF-A aptamer t22-OMe discovered by Ruckman et al. (21) and a commercially available neutralizing VEGF-A monoclonal antibody. We used the aptamer 41t, which is capable of binding with high affinity to the a chain of the platelet-derived growth factor protein (22), as a negative control; it did not inhibit VEGF-A detection (Fig. 3A). The IC^sub 50^ value for the aptamer and the antibody was approximately 30 pmol/L. We also analyzed the inhibitory effects of the VEGF-A aptamer and the neutralizing antibody by the degree of VEGFR-2 phosphorylation in intact cells; their IC^sub 50^ values were approximately 200 nmol/L and 1 nmol/L, respectively (Fig. 3B). We next analyzed the effect of a monoclonal antibody that inhibits the interaction between VEGF-A and VEGFR-2 by binding to the receptor and preventing its dimerization. Placental growth factor was used as a negative control. This protein competes with VEGF-A for binding to VEGFR-1, but it does not bind to VEGFR-2 (Fig. 4A) (8). The IC^sub 50^ dose for the neutralizing VEGFR-2 antibody was approximately 5 nmol/L when 1 pmol/L of VEGF-A was incubated with 1 nmol/L of VEGFR-2. The IC^sub 50^ estimate for VEGFR-2 phosphorylation in cells was approximately 3 nmol/L (Fig. 4B).
Besides protein- and nucleic acid-based inhibitors, we also analyzed the inhibitory effects of a low molecular weight VEGF-A inhibitor, GFA-116 (23) (Fig. 5A). The IC^sub 50^ for GFA-116 was 5 [mu]mol/L when 1 pmol/L of VEGF-A was incubated with 1 nmol/L of VEGFR-2. The IC^sub 50^ value for the effect of GFA-116 on VEGFR-2 phosphorylation (Fig. 5B) was approximately 1 [mu]mol/L.
Discussion
We have demonstrated that PLA is suitable for monitoring interactions between growth factors and their receptors, in this case VEGF-A binding to its receptors VEGFR-1 and VEGFR-2, and for analyzing the effects of agents that disrupt such interactions. The results obtained with PLA correlate well with results obtained when the effects of inhibitors were evaluated by measuring VEGFR-2 phosphorylation, although the observed IC^sub 50^ values for the inhibitors were generally higher with the latter method. The discrepancy can be explained either by the lower VEGF-A concentrations used in the PLA or by the complexity of the cellular environment in the phosphorylation studies affecting the inhibition process. The specificity of the results was ascertained by the use of inhibitors against related proteins that served as negative controls.
The successful characterization of VEGF-A-binding inhibitors implies a general applicability for PLA, which is especially convenient for large-scale screenings. Large arrays of inhibitors are tested each year, yet only a few of them (e.g., antiangiogenic compounds) reach clinical trials. There is a major need for improvements in the secondary screening of drug candidates, because separate systems are often required to evaluate the effects with maximal accuracy. Proteinprotein interactions are considered difficult targets for inhibition screening, and PLA may offer significant advantages over conventional methods. For example, PLA allows extremely sensitive and specific label-free detection of proteins in 1-[mu]L sample volumes, thereby reducing reagent expenditures by a factor of 1 000 compared with regular sandwich ELISAs.
CONCLUSIONS
PLA is a promising approach for the automated analysis of protein interactions and the screening of inhibitor libraries. The technique allows evaluation of the apparent affinity (IC^sub 50^) from a dose- response curve. The total time of a PLA (including DNA amplification and analysis) is 3 h, with minimal manual work and reagent additions. Finally, an in situ variant of PLA (24) can be used to visualize drug effects at the cellular level in tissue samples collected from treated individuals.
Grant/Funding Support: This work was supported by grants from the Swedish Research Councils for Medicine and for Natural and Engineering Sciences, the Knut and Alice Wallenberg Foundation, the Swedish Cancer Society, the Graduate Research School in Genomics and Bioinformatics, the Uppsala Bio-X, and the EU-FP6 integrated project MolTools. Other support includes funding to A. Hamilton (NIH GM35208) and S. Sebt i(CA 78038).
Financial Disclosures: U. Landegren and S. Fredriksson are listed as inventors on patents describing the proximity ligation technology and are founders of the company Olink AB, which exploits the proximity ligation technology.
Acknowledgments: We thank Joanna Chmielewska, Marten Winge, and an anonymous reviewer for helpful comments on the manuscript. We also thank Lena Claesson-Welsh for kindly providing the PAE/KDR.11 cells and Lena Spangberg for excellent technical assistance.
5 Nonstandard abbreviations: VEGF-A, vascular endothelial growth factor A; VEGFR-1, VEGF receptor 1; PLA, proximity ligation assay; STV, streptavidin; IC^sub 50^, half-maximal inhibitory concentration.
References
1. Folkman J. Tumor angiogenesis: therapeutic implications. N Engl J Med 1971;285:1182-6.
2. Folkman J. Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat Med 1995;1: 27-31.
3. Ferrara N. Vascular endothelial growth factor: basic science and clinical progress. Endocr Rev 2004;25:581-611.
4. National Cancer Institute. US National Institutes of Health, http://www.cancer.gov/ctinicaltrials/ developments/anti-angio-table (Accessed December 2007).
5. List AF. Vascular endothelial growth factor signaling pathway as an emerging target in hematologic malignancies. Oncologist 2001;6(Suppl 5): 24-31.
6. Lee JC, Chow NH, Wang ST, Huang SM. Prognostic value of vascular endothelial growth factor expression in colorectal cancer patients. Eur J Cancer 2000;36:748-53.
7. Poon RT, Fan ST, Wong J. Clinical implications of circulating angiogenic factors in cancer patients. J Clin Oncol 2001;19:1207- 25.
8. Park JE, Chen HH, Winer J, Houck KA, Ferrara N. Placenta growth factor. Potentiation of vascular endothelial growth factor bioactivity, in vitro and in vivo, and high affinity binding to FIM but not to Flk-1/KDR. J Biol Chem 1994;269: 25646-54.
9. Glaser BM, D’Amore PA, Seppa H, Seppa S, Schiffmann E. Adult tissues contain chemoattractants for vascular endothelial cells. Nature 1980; 288:483-4.
10. Folkman J, Haudenschild CC, Zetter BR, Long-term culture of capillary endothelial cells. Proc Natl Acad Sci USA 1979;76:5217- 21.
11. Gimbrone MA Jr, Cotran RS, Leapman SB, Folkman J. Tumor growth and neovascularization: an experimental model using the rabbit cornea. J Natl Cancer Inst 1974;52;413-27,
12. Sundberg SA. High-throughput and ultra-high-throughput screening: solution- and cell-based approaches. Curr Opin Biotechnol 2000; 11:47-53.
13. Boswoith N, Towers P. Scintillation proximity assay. Nature 1989;341:167-8.
14. Gullberg M, Gustafsdottir SM, Schallmeiner E, Jarvius J, Bjamegard M, Betsholtz C, et al. Cytokine detection by antibody- based proximity ligation. Proc Natl Acad Sci U S A 2004;101:8420-4.
15. Rollman O, Jensen UB, Ostman A, Bolund L, Gustafsdottir SM, Jensen TG. Platelet derived growth factor (PDGF) responsive epidermis formed from human keratinocytes transduced with the PDGF beta receptor gene. J Invest Dermatol 2003;120:742-9.
16. Bjarnegard M, Enge M, Norlin J, Gustafsdottir S, Fredriksson S, Abramsson A, et al. Endothelium-specific ablation of PDGFB leads to pericyte loss and glomerular, cardiac and placental abnormalities. Development 2004;131:1847-57.
17. Gustafsdottir SM, Nordengrahn A, Fredriksson S, Wallgren P, Rivera E, Schallmeiner E, et al. Detection of individual mkrobial pathogens by proximity ligation. Clin Chem 2006;52:1152-60.
18. Fredriksson S, Dixon W, Ji H, Koong AC, Mindrinos M, Davis RW. Multiplexed protein detection by proximity ligation for cancer btomarker validation. Nat Methods 2007;4:327-9.
19. Shibuya M, Ito N, Claesson-Welsh L. Structure and function of vascular endothelial growth factor receptoM and -2. Curr Top Microbiol Immunol 1999;237:59-83.
20. Terman BI, Dougher-Vermazen M, Carrion ME, Dimitrov D, Armellino DC, Gospodarowia D, Bohlen P. Identification of the KDR tyrosine kinase as a receptor for vascular endothelial cell growth factor. Biochem Biophys Res Commun 1992;187:1579-86.
21. Ruckman J, Green LS, Beeson J, Waugh S, Gillette WL, Henninger DD, et al. 2′-Fluoropyrimidine RNA-based aptamers to the 165-amino acid form of vascular endothelial growth factor (VEGF165). Inhibition of receptor binding and VEGF-induced vascular permeability through interactions requiring the exon 7-encoded domain. J Biol Chem 1998;273:20556-67.
22. Green LS, Jellinek D, Jenison R, Ostman A, Heldin CK, Janjic N, Inhibitory DNA ligands to platelet-derived growth factor B- chain. Biochemistry 1996;35:14413-24.
23. Sun J, Blaskovich MA, Jain RK, Delarue F, Paris D, Brem S, et al, Blocking angiogenesis and tumorigenesis with GFA-116, a synthetic molecule that inhibits binding of vascular endothelial growth factor to its receptor. Cancer Res 2004; 64:3586-92.
24. Soderberg O, Gullberg M, Jarvius M, Ridderstrale K, Leuchowius KJ, Jarvius J, et al. Direct observation of individual endogenous protein complexes in situ by proximity ligation. Nat Methods 2006;3:995-1000.
Sigrun M. Gustafsdottir,1 Stefan Wennstrom,1 Simon Fredriksson,2 Edith Schallmeiner,1 Andrew D. Hamilton,3 Said M. Sebti,4 and Ulf Landegren1*
1 Rudbeck Laboratory, Department of Genetics and Pathology, Uppsala University, SE-75185 Uppsala, Sweden; 2 Olink Bioscience, Dag Hammarskjoldsvag 54A, 75183 Uppsala, Sweden; 3 Yale University, New Haven, CT; 4H. Lee Moffitt Research Institute, University of South Florida, Tampa, FL.
* Address correspondence to this author at Rudbeck Laboratory, Department of Genetics and Pathology, Uppsala University, Dag Hammarskjoldsvag 20, SE-751 85 Uppsala, Sweden. Fax 46-18-4714808; e- mail ulf.landegren@genpat.uu.se.
Received October 25, 2007; accepted April 4, 2008.
Previously published online at DOI: 10.1373/clinchem.099424
Copyright American Association for Clinical Chemistry Jul 2008
(c) 2008 Clinical Chemistry. Provided by ProQuest Information and Learning. All rights Reserved.
