• E-mail
• Print
• Comment
• Font Size
• Digg
• del.icio.us
• Discuss article

HLA-E Protects Glioma Cells From NKG2D-Mediated Immune Responses In Vitro: Implications for Immune Escape In Vivo

Posted on: Wednesday, 15 June 2005, 03:00 CDT

Abstract

The nonclassical MHC class I molecule HLA-E is the only known ligand for CD94/NKG2A and CD94/NKG2C expressed on NK and CD8^sup +^ &946; and &948; T cells. HLA-E may transmit either activating signals via CD94/NKG2C or inhibitory signals mediated by CD94/NKG2A. Here we show that HLA-E is expressed at mRNA and protein level in human long-term glioma cell lines, primary ex vivo polyclonal glioblastoma cell cultures and surgical glioblastoma specimens. Furthermore, immunohistochemistry revealed an enhanced in vivo expression of HLA-E in gliomas of lower grades and a massive overexpression in grade IV glioblastomas compared with normal CNS tissue. An immune-inhibitory effect of HLA-E on tumor-specific CTL has already been described. We show that siRNA-mcdiated silencing of HLA-E or blocking of CD94/NKG2A enables NKG2D-mediated lysis of ^sup 51^Cr-labeled tumor cells by NK cells. Thus, our study provides the first evidence that expression and interaction of HLA-E on cancer cells with CD94/NKG2A expressed on lymphocytes compromises innate anti-tumor immune responses.

Key Words: Anti-tumor immunity, CD94/NKG2A, Glioma, HLA-E, NK cells, NKG2D.

INTRODUCTION

Tumor cell escape from host immune surveillance is thought to be a critical prerequisite for the clinical manifestation of cancer (1). Accordingly, mutated cells that express potentially immunogenetic tumor antigens and activating NK cell ligands tend to be equipped with even stronger immune-inhibitory mechanisms. Human glioblastoma is a highly lethal tumor that is paradigmatic for its ability to suppress effective anti-tumor immune responses (2). The expression of ligands for the activating NK and costimulatory T cell receptor NKG2D (3), which we have previously described on glioma cells (4), is insufficient to overcome glioblastoma-derived inhibitory signals. This may partly be explained by impaired NKG2D expression on immune cells of glioma patients. In vitro, glioma cell supernatant down-regulates NKG2D expression in a TGF-β- dependent manner (5), confirming the major role of TGF-β in the immune escape of malignant gliomas (2).

Glioma cells show high expression levels of MHC class I molecules (4), which inhibit NK cell-mediated lysis, most likely by interacting with killer cell Ig-like receptors. A second class of NK receptors comprises heterodimers formed by the C-type lectin like molecules of the Natural killer group 2 (NKG2) and CD94 (6). Only NKG2D does not dimerize with CD94. Functionally, NKG2A and its splice variant NKG2B transmit inhibitory signals, whereas NKG2C, NKG2D, NKG2E, and its splice variant NKG2H form activating receptors (7). The major ligand for CD94/NKG2A is HLA-E (or its murine homolog Qa-1) (8, 9). HLA-E also binds CD94/NKG2C, albeit with lower affinity (10). HLA-E expression depends on its binding to leader sequences of certain HLA class I molecules, including HLA-G (11), and therefore reflects the amount of classical class I molecules expressed by the cell. Both CD94/NKG2A and NKG2D are expressed by NK and CD8^sup +^ &946; and &948; T cells. In contrast to NKG2D, NKG2A expression is enhanced by TGF-β (12). Like HLA-G but unlike classical MHC class I molecules, HLA-E shows only a very limited polymorphism and is thought to contribute to immune tolerance at the maternal-fetal interface (13). For HLA-E, 2 gene products, but no alternative splicing have been described (14). Knockout mice lacking the murine homolog of HLA-E, Qa-1, are more susceptible to autoimmune diseases (15). Aberrant HLA-E expression has been described in leukemia-derived cell lines as well as in single melanoma, pancreatic, and cervical carcinoma cell lines where its expression has been related to the availability of free β2- microglobulin (16). For short-term ovarian carcinoma cell lines, HLA- E-dependent inhibition of tumor cell lysis by peptide- and allo- specificity has been demonstrated (17). However, the effect of HLA- E on anti-tumor immune responses by the innate immune system has not been investigated to date. Since NK cells are regulated by equilibrium between activating and inhibitory signals (6), we investigated whether ligation of the inhibitory receptor CD94/NKG2A by HLA-E may oppose the immune-stimulatory action of signals received via NKG2D.

MATERIALS AND METHODS

Cell Lines

The human SV-FHAS astrocytic cell line was provided by D. Stanimirovic (Ottawa, Canada). The human malignant glioma cell lines were provided by Dr. N. de Tribolet (Lausanne, Switzerland). Unlike LN-229 cells grown in other laboratories, our LN-229 cell line still harbors wild-type p53 and is therefore referred to as LNT-229 ("T" for Tbingen) ( 18). LNT-229 MICA transfectants have been described (4). Primary glioblastoma cells were established from freshly resected tumors, cultured in monolayers and used between passages 4 and 9. Glioma cells were maintained in DMEM medium supplemented with 2 mM L-glutamine (Gibco Life Technologies, Paisley, UK), 10% fetal calf serum (Biochrom KG, Berlin, Germany), and penicillin (100 IU/ ml)/streptomycin (100 g/ml) (Gibco). Immune cells were grown in RPMI 1640 medium containing the same supplements. To obtain human polyclonal NK cell populations, monocyte-depleted PBL prepared by density gradient centrifugation (Biocoll, Biochrom KG) were cultured on irradiated RPMI 8866 feeder cells for 10 days (19). NKL cells were kindly provided by M. J. Robertson (Indianapolis, IN) (20).

Immunohistochemistry

All tissue specimens were from the Brain Bank of the Institute of Brain Research of the University of Tubingen where they had been evaluated by at least 2 neuropathologists in routine diagnostics. Immunohistochemical tissue labeling was performed on 3.5-m-thick, formalin-fixed and paraffinembedded samples using the Benchmark immunohistochemistry system (Ventana, Strasbourg, France). Endogenous peroxidase of the tissue sections was blocked with 3% H^sub 2^O^sub 2^ in methanol for 14 minutes. A cell conditioning pretreatment was performed for 68 minutes. A mouse monoclonal IgG^sub 1^ antibody raised against a recombinant HLA-E peptide (clone MEM-E/07, Abeam, Cambridge, UK) was applied at 1:20 for 32 minutes. Binding specificity of the antibody was controlled using an IgG^sub 1^ isotype control. Avidin and biotin blockers were applied to the samples for 4 minutes followed by an 8-minute incubation with one drop of I-View-Biotin Ig (Ventana). For diaminobenzidinc (DAB) visualization, the sections were incubated with one drop of I-View SA-HRP for 8 minutes and then with DAB/H^sub 2^O^sub 2^ for additional 8 minutes. The sections were finally incubated with a copper enhancer (Ventana) for 4 minutes, washed, counterstained with hematoxylin, and mounted. Evaluation of the immunohistochemical stainings and photographic documentation was performed using an Olympus BX50 light microscope.

Real-Time PCR

Total RNA was prepared from long-term glioma cell lines, polyclonal primary glioma cell cultures, or surgical glioma specimens using RNAeasy (Qiagen, Hilden, Germany) and transcribed according to standard protocols. cDNA amplification was monitored using SYBRGreen chemistry on the ABI PRISM 7000 Sequence Detection System (Applied Bio-Systems, Weiterstadt, Germany). The conditions for all PCR reactions were: 40 cycles, 95C for 15 seconds and 60C for 1 minute, using the following specific primers (forward, reverse): 18S: 5'-CGGCTACCACATCCAAGGAA-3' (450-469), 5'- GCTGGAATTACCGCGGCT-3' (636-619); HLA-E: 5'-GGGACACCGCACAGATTTT-3' (266-284), 5'CTCAGAGGCATCATTTGACTTTT (519-497) (17). Data analysis was done using the &916;C^sub T^ method for relative quantification. Briefly, threshold cycles (C^sub T^) for 18S rRNA (reference) and NKG2DL (sample) were determined in duplicate. The values obtained for untreated cells were arbitrarily defined as the standard value (100%) and determined the relative change (rI) in copy numbers according to the formula rI = 2^sup -([C^sub T^ Sample - C^sub T^ Reference] - [C^sub T^ Standard sample - C^sup T^ Standard reference])^

Monoclonal Antibodies and Flow Cytometry

The following monoclonal antibodies (mAbs) were used for the assessment of cell surface expression or the blocking of CD94/ NKG2A, NKG2D, HLA-E, MICA, CD3, and CD56: DX22 CD94 (eBioscience, San Diego, CA), MAB 139 IgG^sub 1^ anti-NKG2D (R&D Systems, Wiesbaden, Germany), 3D12 anti-HLA-E (kindly provided by D. Geraghty, Seattle, WA), W6/32 and MHC class I, BAMO1 IgG^sub 1^ anti- MICA/B, BAMO3 IgG^sub 1^ anti-MICA/B, AMO1 IgG^sub 1^ anti-MICA (kindly provided by A. Steinle, Tbingen, Germany), HIT3a IgG^sub 2a^ anti-CD3-FITC (BD Pharmingen, Heidelberg, Germany), HIT8a IgG^sub 1^ anti-CD8-PE (BD Pharmingen), and B159 IgG^sub 1^ anti-CD56-PE (BD Pharmingen). Conjugated and unconjugated IgG^sub 1^ and IgG^sub 2a^ isotype-matched mAbs were used as controls (BD Pharmingen). Glioma cells were detached using Accutase (PAA, Wien, Austria), preincubated in PBS with 2% BSA and stained with the specific mAb or matched mouse Ig isotype (5 g/ml) for 30 minutes on ice. FITC- and PE-conjugated goat anti-mouse IgG (Sigma, Deisenhofen, Germany) was used for detection. Fluorescence was measured in a DakoCytomation(Freiburg, Germany) Cyan MLE analyzer or in a Becton Dickinson FACScalibur. Specific fluorescence indexes (SFI) were calculated by dividing mean fluorescence obtained with specific antibody by mean fluorescence obtained with control antibody.

siRNA

2 x 10^sup 5^ glioma cells were seeded in a 6-well plate. Twenty- four hours later they were transfected with 10 nM of either HLA-E siRNA (535-553): 5'-GCCUACCUGGAAGACACAU(dTdT)-3' and 5' AUGUGUCUUCCAGGUAGGC (dTdT)-3' or irrelevant GL3 control siRNA: 5'- CUUACGCUGAGUACUUCGA(dTdT)-3' and 5'UCGAAGUACUCAG CGUAAG(dTdT)-3' (21), using 8 l of TransIT-TKO Transfection Reagent (Mirus, Madison, WI). Cells were analyzed and used for functional assays 72 hours posttransfection.

Cytotoxicity Assay

Cytotoxicity was assessed in 4-hour ^sup 51^Cr release assays in the absence or presence of 10 g/ml of various mAb. NK cells were pretreated with normal human IgG to prevent antibody-dependent cellular Cytotoxicity. Effector and ^sup 51^Cr-loaded target cells were incubated at various effectortarget (E:T) ratios for 4 hours in the absence or presence of control IgG or specific antibody. Spontaneous ^sup 51^Cr release was determined by incubating the target cells with medium alone. Maximum release was determined by adding NP-40 (2%). The percentage of ^sup 51^Cr release was calculated as follows: 100 ([experimental release - spontaneous release]/[maximum release - spontaneous release]).

Statistics

Analysis of significance was performed using the 2-tailed Student t-test with p < 0.05 considered significant and p < 0.01 considered highly significant (Excel, Microsoft, Seattle, WA). Real-time PCR was performed twice (in duplicate) using 2 different cDNA preparations; for all other assays one representative out of 3 experiments is shown.

RESULTS

Human Malignant Glioma Cell Lines Express HLA-E mRNA and Protein

Whereas a previous study that screened for HLA-E expression in a variety of different tumor entities (not including glioma) (16) found HLA-E expression only in individual cell lines, HLA-E expression seems to be a common feature of glioblastoma cell lines. Using quantitative real-time PCR, we detected HLA-E mRNA (Fig. 1A) expression in all of 12 permanent and 3 primary glioma cell cultures investigated, but not in the SV40-transformed nonneoplastic astrocytic cell line SV-FHAS. PBL, which expressed higher levels of HLA-E than any nontransfected cell line ΔC^sub T^ values relative to 18S RNA, ranged from 8 (TU 113 and Tu 151 cells) to 13 cycles (U373MG cells) (16). Primary glioblastoma specimens (n = 3) showed HLA-E expression similar to that found in primary glioblastoma cell cultures. When assessed on a gel, HLA-E amplification products yielded a single band at the predicted size of 254 bp (data not shown). Flow cytometry confirmed the presence of HLA-E on the cell surface of all glioma cell lines (Fig. 1 B). Of note, both mRNA and protein expression at the cell surface were considerably higher in the primary glioma cell cultures, suggesting that HLA-E expression is down-regulated during long-term propagation in vitro. This was confirmed by repeated analysis of the same cell lines after prolonged ex vivo culture (data not shown). Among the permanent cell lines, LN-428 cells showed the highest, U373MG cells the lowest expression on mRNA and protein level. Nonneoplastic, SV- 40 transformed human astrocytes (SV-FHAS) showed no detectable HLA- E expression at protein or mRNA level (Fig. 1B and data not shown). The correlation between the qPCR and the flow cytometry data (r^sup 2^ = 0.9) suggests that HLA-E expression is regulated primarily at transcriptional level, even though posttranscriptional and posttranslational regulation cannot be excluded. While expression of classical MHC class I molecules is thought to be a prerequisite for HLA-E expression and is indeed found on all the glioma cell lines investigated (5, 22), the respective SFI values obtained with W6/32 anti-MHC class I and 3D12 anti-HLA-E antibody showed no significant correlation (p > 0.05, data not shown).

FIGURE 1. HLA-E expression in human glioma cells. (A) HLA-E mRNA expression was assessed by quantitative RT-PCR in human glioma cell lines, primary glioblastoma cell cultures (TU113, TU132, and TU159), surgical glioblastoma specimens and nonneoplastic astrocytes (SV- FHAS) and is shown relative to PBL included as a positive control. (B) Flow cytometric analysis of HLA-E expression by human malignant glioma cell lines, primary glioma cell cultures, and nonneoplastic SV-FHAS astrocytes. The cells were stained with 10 g/ml HLA-E mAb (filled profiles) or isotype-matched Ig (open profiles). Expression was quantified as specific fluorescence indexes (SFI) values (mean fluorescence^sub specific mAb^/mean fluorescence^sub isotyp control^), indicated in the upper right of each panel.

HLA-E Is Overexpressed in Human Glioblastoma In Vivo

Only very low HLA-E expression levels were detected in normal CNS tissue specimens of the grey and white matter (n = 5) (Fig. 2A). HLA- E expression was mainly restricted to endothelial cells of small intraparenchymal blood vessels. To an even lower extent, HLA-E was found on glial cells in the white matter. WHO grade II diffuse astrocytomas (n = 5) showed an upregulation of HLA-E both on tumor and endothelial cells (Fig. 2B). The immunohistochemical investigations showed no clear-cut differences in the expression patterns of WHO grade II and III (n = 5) astrocytomas (Fig. 2C). In contrast, in WHO grade IV glioblastomas (n = 20), HLA-E expression levels were uniformly higher (Fig. 2D) than in glial neoplasms of lower WHO grades. Furthermore the distribution pattern in glioblastomas was characterized by an accumulation of HLA-E- positive tumor cells in pseudopalisades surrounding necrotic foci (Fig. 2D), with endothelial cells of glioblastomas also expressing HLA-E (Fig. 2D). Of note, HLA-E expression differed very little between the various samples of one tumor entity. Quantitative RT- PCR from primary surgical specimens confirmed the overexpression of HLA-E in grade III astrocytomas and grade IV glioblastomas. Again, the expression levels were rather uniform within one tumor entity with a difference between grades III and IV.

FIGURE 2. HLA-E expression in normal CNS and glioma tissue specimens in vivo. (A) Normal white matter, only very few glial or endothelial cells express HLA-E. (B) HLA-E is upregulated on neoplastic and endothelial cells in astrocytomas WHO grade II (Inlay: IgG^sub 1^ isotype control). (C) WHO grade III astrocytomas exhibit a distribution pattern similar to WHO grade II astrocytomas (Inlay: IgG^sub 1^ isotype control). (D) In glioblastomas, a massive HLA-E expression is seen predominantly in palisades surrounding necrotic foci (Inlay: IgG^sub 1^ isotype control). (E) HLA-E mRNA expression was assessed by quantitative RT-PCR in surgical specimens from grade III astrocytomas (n = 5) and glioblastomas (grade IV) (n = 3) and is shown relative to normal human brain.

Downregulation of HLA-E Enhances the Susceptibility of LN-428 Glioma Cells to NK Cell Lysis

To delineate a functional role for HLA-E on glioma cells, we suppressed HLA-E expression in LN-428 and LNT-229 cells by RNA interference. At 72 hours posttransfection, the SFI value for HLA-E surface expression decreased to 1.2 in LN-428 compared with 2.1 in control-transfected cells and to 1.0 in LN-229 compared with 1.4 in control-transfected cells (Fig. 3A). Accordingly, HLA-E siRNA- treated cells were much more susceptible to lysis by polyclonal human NK cells. Addition of blocking anti-CD94 antibody had an equivalent effect in LNT-229 and an even greater effect in LN-428 cells, consistent with the incomplete suppression of HLA-E surface expression in LN-428 (Fig. 3B). Accordingly, addition of anti-CD94 antibody enhanced the lysis of siRNA-transfected LN-428 cells, whereas no additive effects were observed in LNT-229 cells. Importantly, downregulation of HLA-E by siRNA had no effect on total MHC class I expression assessed with W6/32 antibody (data not shown).

FIGURE 3. HLA-E counteracts NKC2D-mediated anti-glioma cell immune response. (A) LN-428 (upper panels) and LNT-229 (lower panels) glioma cells were treated with HLA-E siRNA or GL3 control siRNA. HLA-E expression was analyzed by flow cytometry after 72 hours as in Figure 1B. (B) Polyclonal NK cells were pretreated with normal human IgC (50 g/ml) to prevent antibody-dependent cellular cytotoxicity. Then they were incubated for 30 minutes with control IgG or anti CD94 mAb (5 g/ml) before they were used in a standard 4 hour ^sup 51^Cr release assay, using LN-428 (left) or LNT-229 (right) glioma cells, pretreated with GL3 control siRNA or HLA-E siRNA as target cells. Data are expressed as specific lysis at different effectontarget (E:T) ratios. (C) Different target cell lines were pretreated with control Ig or anti-MICA BAMO-1 mAb. NKL effector cells were pretreated with control Ig, anti-CD94, or anti- NKG2D mAb for 30 minutes before use in ^sup 51^Cr release cytotoxicity assays. LNT-229.neo or LN-229T.MICA were used as targets. The specific lytic activities are given for an E:T ratio of 40:1 (mean SD, t-test, p < 0.01, compared with isotype control Ig oranti-CD94 mAb).

Functional Antagonism Between CD94/NKG2A and NKG2D

We have previously shown that glioma cells express activating Hgands for the NKG2D receptor (4). However, physiological expression levels of NKG2DL were insufficient to induce NKG2D-mediated anti- tumor immune responses, whereas overexpression of MICA induced effective immune responses against human LNT-229 glioma cells in a nude mouse xenograft model. Since NK cell activation depends on the respective input from activating and inhibitory receptors, we hypothesized that inhibitory signals transmitted via CD94/NKG2A counteract the immune-stimulatory effects of NKG2DL. Therefore we investigated whether blocking ofthe interaction of HLA-E with CD94/ NKG2A enables NKG2D-dependent immune responses. In fact, the resistance of LNT-229 glioma cells to lysis by NKL cells was overcome by blocking CD94 (Fig. 3C). This effect was partly reversed by the masking of MICA and nullified by a neutralizing antibody to NKG2D. MICA-overexpressing glioma cells were much more susceptible to NKL cell-mediated lysis. Again, addition of anti-CD94 resulted in enhanced lysis, demonstrating that HLA-E can act even in the presence of a strong stimulus on NKG2D. Since blocking NKG2A- specific antibodies are not commercially available, we were unable to delineate the contribution of the different NKG2 subtypes. However, being the major inhibitory NKG2 receptor, CD94/NKG2A is most likely involved in inhibiting NK cell-mediated lysis.

DISCUSSION

The contribution of the innate immune system to tumor immune surveillance has attracted considerably attention during the last few years. In particular, the induction of stress-inducible ligands for the activatory NK cell receptor NKG2D may prompt early recognition of transformed cells. However, in cases where a tumor becomes clinically detectable, the tumor cells have apparently escaped immune surveillance (1). This may be explained by the presence of tumor-derived immune-inhibitory signals that counteract the stimulatory signals originating from the transformed cells. We and others have previously identified a number of factors implicated in the immune escape of malignant gliomas (2, 5). Further, we have also explored the potential for an NKG2D-mediated immunotherapy of these tumors (4) and shown that glioma cells express appropriate ligands for NKG2D, which are for one counteracted by killer cell Ig- like receptor engagement with HLA class I molecules (4). Accordingly, the molecular mechanisms that prevent an activation of the NKG2D pathway in vivo are of potential therapeutic interest.

Here we have demonstrated for the first time that HLA-E is expressed in malignant glioma cell lines (Fig. 1) and in vivo in gliomas of different WHO grades (Fig. 2). Immunohistochemical investigations of normal grey and white matter have revealed only very few HLA-E-positive glial and endothelial cells, whereas a strong HLA-E overexpression was observed in gliomas of different WHO grades with HLA-E expression increasing with grade of malignancy.

Assuming that the major role of HLA-E is the modulation of host anti-tumor immune reactions, the selection pressure acting on glioma cells to express HLA-E in vivo would be lost upon in vitro culture. Accordingly, investigation of short-term cultures derived from primary glioblastoma tissue shows that HLA-E expression is downregulated during long-term in vitro culture. This hypothesis is further supported by the high levels of HLA-E protein expressed by tumor cells within primary surgical material from grade IV gliomas (Fig. 2). Since primary tumor material obtained by resection may contain significant numbers of microglial cells, infiltrating lymphocytes, and endothelial cells that may express HLA-E, the RT- PCR data (Fig. 2E) must be treated with caution. It has been reported here only to support the immunohistochemistry data. Interestingly, expression of classical MHC class I molecules assessed with W6/32 antibody showed an opposite trend and was higher on permanent cell lines than on primary glioma cell cultures (p < 0.01) (5, 23). This finding also shows the need for a primary material-based reassessment of HLA-E expression in tumors of different origins.

Previous studies failed to reveal a functional significance of HLA-E expression for the prevention of innate anti-tumor immune responses. Using both blocking antibodies and siRNA, we demonstrated that HLA-E expression on permanent glioma cell lines suppressed NK cell-mediated target cell lysis. In LN-428 cells where HLA-E expression was not completely suppressed by siRNA, additional blockade of the receptor CD94/NKG2A enhanced the lysis of siRNA- treated cells (Fig. 3B). Importantly, anti-NKG2D nullifies the effect of CD94/NKG2A inhibition on NKL cells, suggesting that the relative signals transmitted by these 2 receptors determine whether an anti-tumor immune response is initiated by the innate immune system. The high expression of HLA-E found on primary glioma cell cultures as well as on glioma tissue specimens suggests that this inhibitory pathway may be of even greater importance in vivo. Since HLA-E expression reflects the amount of classical class I expression, it is curious to note that glioma cells express classical class I molecules in vitro and in vivo, although normal brain tissue show no or very low expression levels (4). Furthermore, we have shown that NKG2D expression is reduced in glioma patients, an effect mediated by glioblastoma-derived TGF-β. CD94/NKG2A expression by T cells, on the other hand, is upregulated by TGF- β (12). Thus, in glioblastoma patients, the equilibrium between the activatory NKG2D and the inhibitory CD94/NK.G2A pathway will be shifted even further towards the suppression of anti-tumor immune responses. Accordingly, HLA-E represents a potentially important target molecule for the relief of immunosuppression in glioblastoma patients and possibly in other tumors as well where its expression and functional significance need to be investigated.

REFERENCES

1. Dunn GP, Old LJ, Schreiber RD. The three Es of cancer immunoediting. Annu Rev Immunol 2004;22:329-60

2. Weller M, Fontana A. The failure of current immunotherapy for malignant glioma. Tumor-derived TGF-beta, T-cell apoptosis, and the immune privilege of the brain. Brain Res Brain Res Rev 1995;21:128- 51

3. Bauer S, Groh V, Wu J, et al. Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. Science 1999;285:727-29

4. Friese MA, Platten M, Lutz SZ, et al. MICA/NKG2D-mediated immunogene therapy of experimental gliomas. Cancer Res 2003;63: 8996- 9006

5. Friese MA, Wischhusen J, Wick W, et al. RNA interference targeting transforming growth factor-β; enhances NKG2D- mediatedantiglioma immune response, inhibits glioma cell migration and invasiveness, and abrogates tumorigenicity in vivo. Cancer Res 2004;64:7596-603

6. Lanier LL. NK cell receptors. Annu Rev Immunol 1998;16:359-93

7. Gunturi A, Berg RE, Forman J. The role of CD94/NKG2 in innate and adaptive immunity. Immunol Res 2004;30:29-34

8. Brand VM, Allan DS, O'Callaghan CA, et al. HLA-E binds to natural killer cell receptors CD94/NKG2A, B and C. Nature 1998;391:795-99

9. Lee N, Llano M, Carretero M, et al. HLA-E is a major ligand for the natural killer inhibitory receptor CD94/NKG2A. Proc Natl Acad Sci USA 1998;95:5199-204

10. Vales-Gomez M, Reyburn HT, Erskine RA, Lopez-Botet M, Strominger JL. Kinetics and pcptide dependency of the binding of the inhibitory NK receptor CD94/NKG2-A and the activating receptor CD94/ NKG2-C to HLA-E. Embo J 1999;18:4250-60

11. Braud V, Jones EY, McMichael A. The human major histocompatibility complex class Ib molecule HLA-E binds signal sequence-derived peptides with primary anchor residues at positions 2 and 9. Eur J Immunol 1997; 27:1164-69

12. Bertone S, Schiavetti F, Bellomo R, et al. Transforming growth factor-beta-induced expression of CD94/NKG2A inhibitory receptors in human T lymphocytes. Eur J Immunol 1999;29:23-29

13. Ishitani A, Sageshima N, Lee N, et al. Protein expression and peptide binding suggest unique and interacting functional roles for HLA-E, F, and G in matemal-placental immune recognition. J Immunol 2003;171:1376-84

14. Ulbrecht M, Honka T, Person S, Johnson JP, Weiss EH. The HLA- E gene encodes two differentially regulated transcripts and a cell surface protein. J Immunol 1992;149:2945-53

15. Hu D, Ikizawa K, Lu L, et al. Analysis of regulatory CD8 T cells in Qa-1-deticient mice. Nat Immunol 2004;5:516-23

16. Marin R, Ruiz-Cabello F, Pedrinaci S, et al. Analysis of HLA- E expression in human tumors, Immunogenetics 2003;54:767-75

17. Malmberg KJ, Levitsky V, Norell H, et al. IFN-gamma protects short-term ovarian carcinoma cell lines from CTL lysis via a CD94/ NKG2A-dependent mechanism. J Clin Invest 2002;110:1515-23

18. Wischhusen J, Naumann U, Ohgaki H, Rastinejad F, Weller M. CP- 31398, a novel p53-stabilizing agent, induces p53-dependent and p53- independent glioma cell death. Oncogene 2003;22:8233-45

19. Valiante NM, Rengaraju M, Trinchieri G. Role of the production of natural killer cell stimulatory factor (NKSF/IL-12) in the ability of B cell lines to stimulate T and NK cell proliferation. Cell Immunol 1992;145: 187-98

20. Robertson MJ, Cochran KJ, Cameron C, et al. Characterization of a cell line, NKL, derived from an aggressive human natural killer cell leukemia. Exp Hematol 1996;24:406-15

21. Elbashir SM, Harborth J, Lendeckel W, et al. Duplexes of 21- nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 2001;411:494-98

22. Wiendl H, Mitsdoerffer M, Hofmcistcr V, et al. A functional role of HLA-G expression in human gliomas: An alternative strategy of immune escape. J Immunol 2002;168:4772-80

23. Castriconi R, Cantoni C, Delia Chiesa M, et al. Transforming growth factor beta 1 inhibits expression of NKp30 and NKG2D receptors: Consequences for the NK-mediated killing of dendritic cells. Proc Natl Acad Sci USA 2003;100:4120-25

Jrg Wischhusen, PhD, Manuel A. Friese, MD, Michel Mittelbronn, MD, Richard Meyermann, MD, and Michael Weller, MD, PhD

From Laboratory of Molecular Neuro-Oncology (JW, MAF, MW), Department of General Neurology, Hertie Institute for Clinical Brain Research; Institute for Brain Research (MM, RM), University of Tubingen Medical School, Tubingen, Germany; and MRC Human Immunology Unit (MAF), Weatherall Institute of Molecular Medicine, University of Oxford, John Radcliffe Hospital, Oxford, United Kingdom.

Send correspondence and reprint requests to: Jrg Wischhusen, Department of General Neurology, Hertie Institute for Cl\inical Brain Research, University of Tbingen, Medical School, Hoppe-Seyler- Str. 3, 72076 Tbingen, Germany; E-mail: joerg.wischhusen@uni- tuebingen.de

JW and MAF contributed equally to this work.

This work was supported by a grant from the Interdisciplinary Centre of Clinical Research Tbingen (IZKF) to MW.

Copyright American Association of Neuropathologists, Inc. Jun 2005

Source: Journal of Neuropathology and Experimental Neurology

More News in this Category