Quantcast
Last updated on May 30, 2012 at 17:55 EDT

A Selection Procedure for Identifying Transgenic Cells and Embryos of Cotton Without the Use of Antibiotics

September 30, 2008
Repost This

By Burke, John J O’Mahony, Patrick J; Oliver, Melvin J; Velten, Jeff

Abstract Transgenic cells containing inserted antibiotic resistance genes and linked genes of interest are routinely selected by exposure to antibiotics. Concerns over the widespread use of antibiotic resistance genes as selectable markers for genetic transformation have motivated researchers to find alternative selection procedures. This study describes the evaluation of an alternative protocol using temperature as the selection tool. In this method, a population of host cells is transformed with a foreign DNA construct that includes at least one gene of interest and an additional sequence encoding a protein that enhances cellular high temperature tolerance. Following transformation, the population of cells is transiently cultured under temperature conditions wherein growth of non-transformed cells is suppressed or prevented, while growth of cells containing the DNA construct continues. Thus, survival and/or significant additional growth is an indication that a cell has been successfully transformed with the DNA construct and can be subsequently recovered for further growth and development. The present study used a heat shock protein (hsp101) gene from Arabidopsis thaliana under the control of a constitutive promoter as a selectable marker; however, alternative potentially suitable genes include: other heat shock proteins; heat shock transcription factors; cold regulated proteins (COR); or protein transcription factors associated with the induction of cold tolerance.

Keywords Transgenic cotton * Selection procedure * Cells * Embryos * High temperature

Introduction

On 14 February 2001, the European Parliament (EP) passed the revised “Council Directive on the deliberate release into the environment of genetically modified organisms (GMOs)” (90/220/EEC). The Directive calls for precautionary measures to be taken when an activity raises threats of harm even if some cause-and-effect relationships are not fully established scientifically. An example of this precautionary principle in the Directive is the proposed phasing out of antibiotic resistance marker genes for GMOs placed on the market by 31 December 2004 (part C) and for experimental GMOs possibly by 31 December 2008 (part B). Commonly used antibiotic- based plant selectable markers are those encoding neomycin phosphotransferase II (NPTII) (Fraley et al. 1986) and hygromycin phosphotransferase (HPT or HYG) (Waldron et al. 1985; Meijer et al. 1991; Li and Murai 1995). In addition, genes encoding resistance to the antibiotics: streptomycin (Jones et al. 1987); spectinomycin (Bretagne-Sagnard and Chupeau 1996); and bleomycin (Hille et al. 1986) have been used for selection. Clearly, the future use of these antibiotic resistance genes in GMO production will be impacted by 90/ 220/EEC.

Although numerous selectable marker genes that do not confer resistance to antibiotics have been identified, many of these genes provide resistance to herbicides (DeBlock et al. 1987, 1989; Fromm et al. 1990; Toki et al. 1992) and may also be problematic in the development of crops for future release. In addition, various selectable marker genes providing resistance to, or a requirement for, specific chemicals have been developed (see Jayne et al. 2000); however, few have been universally accepted by biotechnologists as efficacy may vary between organisms.

In a departure from established practice, we have discovered that cells successfully genetically transformed may be selected using a marker encoding a protein that confers resistance to temperature extremes. Numerous heat shock-associated coding sequences have been isolated and described {e.g., Schoffl et al. (1998), Vierling (1991), Nover and Scharf (1997), Lindquist (1998), and Zimmerman et al. (1999)}, and any one of these HSPs is a potential candidate for use in temperature-based selection. The present study describes a method for temperature selection of transgenic cells using a gene encoding the Arabidopsis thaliana heat shock protein 101, a protein reported to play a crucial role in thermotolerance (Queitsch et al. 2000).

Materials and Methods

The Athsp101 was placed under control of the constitutive SuperPromoter (Ni et al. 1995) within the binary plasmid pElSOl (available from Stanton Gelvin, Purdue University), and transferred into cotton (Gossypium hirsutum L., Coker 312) hypocotyl cells using Agrobacterium tumefaciens co-cultivation (Bayley et al. 1992). Callus induced after co-culture of the plant tissue with A. tumefaciens is a mixture of transformed and non-transformed cells as no selection pressure is applied during the ensuing callus growth. The callus is subsequently moved to a liquid cell-suspension medium and grown with shaking to promote embryogenesis. Resulting cell clusters and pre-embryos are transferred to a solid medium, followed by a timed exposure to elevated temperatures in a 5O0C incubator to select for heat-tolerant genetic transformants.

The plasmid used for transformation, pE1801-hsp101 (SuperPromoter::hsp 101, Fig. 6A), was introduced into the EHA105 strain of A. tumefaciens (Hood et al. 1993) by direct transformation as described by Walker-Peach and Velten (1984). The transformation protocol (see Fig. 1) used hypocotyls cut from Coker 312 seedlings and submerged for 30 s (at 28[degrees]C) in a diluted 24-h-old culture of EHA 105 containing the SuperPromoter::hspl01 binary plasmid [diluted 1:19, in MSNH (4.4 g/L MS medium (Murashige and Skoog 1962) with Gamborg's vitamins (Gamborg et al. 1968))]. The hypocotyl sections were then blotted dry on sterile filter paper to remove excess bacteria, transferred onto T2 plates (4.4 g/L MS medium with Gamborg’s vitamins + 0.453 [mu]M 2,4-D and 2.325 [mu]M kinetin + 30 g/L D-(+)-glucose + 2 g/L phytagel) and co-cultured for 2 d (28[degrees]C, 16 h/8 h light/dark, except for high-temperature treatments, the same conditions were used for all incubations). The co-cultured hypocotyls were then blotted on sterile filter paper, transferred to MS2NK CL plates (4.4 g/L MS medium with Gamborg’s vitamins + 2 g/L phytagel + 30 g/L D-(+)-glucose + 10.74 [mu]M alphanaphthaleneacetic acid + 0.465 [mu]M kinetin + 266 mg/L cefotaxime) and callus grown over a 12-wk period (media changed every 3 wk). At this stage, callus was cut from the hypocotyls and transferred to fresh MS2NK 1/4CL plates (4.4 g/L MS medium with Gamborg’s vitamins + 2 g/L phytagel + 30 g/L D-(+)-glucose + 10.74 [mu]M alpha-naphthaleneacetic acid + 0.465 [mu]M kinetin + 67 mg/L cefotaxime) for 3 wk. The calluses were subsequently moved into liquid MSNH cell suspension medium (4.4 g/L MS medium with Gamborg’s vitamins + 30 g/L D-(+)glucose) and placed on a rotary shaker at 110 rpm for 7 d.

Figure 1. Flow diagram of heat selection transformation protocol. Dashed outline indicates time spent without antibiotic (Claforan) selection against A. tumefaciens growth.

Heat selection in suspension culture. After 7 d on the shaker (28[degrees]C), cell suspensions were transferred to a 50[degrees]C rotary shaker water bath under room lights. Representative flask temperature was determined by placing a thermocouple into a flask containing MSNH medium without cells. Incubation times evaluated were 5, 10, 20, 30, 45, and 100 min at 50[degrees]C. Upon removal from the 50[degrees]C bath, the warm culture medium was rapidly removed by aspiration (non-shaken cotton cell clusters settle within 30 s) and replaced with fresh 25[degrees]C MSNH medium. The embryogenic cell suspensions were then transferred to MSK (4.4 g/L MS medium with Gamborg’s vitamins + 30 g/L D-(+)-glucose + 2 g/L phytagel + 18.8 mM KNO^sub 3^) plates and moved to a 280C tissue culture room where embryo development was monitored over a 9-d period.

Heat selection on solid media. Non-heated embryogenic cell suspension cultures were transferred to MSK plates; one half of the MSK plates per cell suspension were then placed in a model E-30B incubator (Percival Scientific Inc., Boone, IA) at a defined temperature for 150 min, whereas the other half remained at 28[degrees]C. Petri dishes were stacked five plates high on each of three shelves within the incubator. A thermocouple was applied to a MSK plate that did not receive a cell suspension aliquot and this reference plate was placed on the middle incubator shelf in the middle of the stack of the MSK plates. Phytagel surface temperature was measured every 5 min throughout the 150-min incubation. Following the heat treatment, the Petri dishes were moved to a 28[degrees]C tissue culture room and embryo development followed over a 9-d period. Incubator temperature settings evaluated were 30,44, 46, 48, 50, and 52[degrees]C. The incubation temperature chosen for subsequent selections was the lowest temperature that significantly reduced non-transgenic cotton embryo viability.

PCR analysis of putative transgenic cotton lines. During cell culture after co-cultivation, plant material was first grown on solid media supplemented with cefotaxime to kill remaining bacteria and then incubated without antibiotic, both during suspension culture (shaking for 7 d at 28[degrees]C, in MSNH media {4.4 g/L MS medium + Gamborg’s vitamins + 30 g/L D-(+)-glucose}) and on solid media (9-14 d at 28[degrees]C on MSK media (4.4 g/L MS medium with Gamborg’s vitamins + 2 g/L phytagel + 30 g/L D-(+)-glucose + 1.9 g/ L KNO^sub 3^). Bacterial growth was not observed within either the suspension culture, nor associated with the embryos propagated on MSK plates indicating that no viable A. tumefaciens remained after antibiotic treatment of the cotton callus material. PCR was thus used to screen directly for transgenic embryos from both heat treated and untreated samples using the “Extract-N-Amp” plant PCR kit distributed by Sigma-Aldrich Corp. (St. Louis, MO) as described in detail in the Technical Bulletin Code MB-965 distributed by Sigma- Aldrich Corporation. The presence of the SuperPromoter:: hsp 101 5′ junction, hsp101::Ags-Terminator 3′ junction, and/or the NPTII selectable marker within transgenic embryos and/or plant genomes was determined using suitable PCR primer sets (see Fig. 6A) (primers P- AGS-> [CCAATACATTACAC TAGC] vs HSP101-5′ [CGGTAATGTTGTAAAATTGA TAAC], hsp101-3 [TGACTCTTTTGGTAGACTATAATG] vs Ags-T [CATCCCAATCTGAATATCC], NPT2-> [CTTGCTCCTGCCGAGAAAGTATC] vs NPT2<[GTAAAGCACGAGGAAGGCGGTC]). Potential contamination of transgenic plants by A. tumefaciens was tested using primers targeting the non-transferred VirD region of the Ti plasmid (Genbank NC_003065, VirD4F [GAAG AAAGCCGAAATAAAGAGG] vs VirD4R [TTGAACG TATAGTCGCCGATA]). Primers for the native cotton cellulose synthase gene (ces1A, GenBank:AY632360, Primers F4 [TGGCTACCAACACCACAAAA] vs R3 [CAACACGAGCAAGATGAG]) were used as positive PCR controls to confirm DNA sample suitability for amplification. Additional PCR analysis of leaf samples from transgenic plants was performed according to the procedure of Xin et al. 2003. Results

Cell suspension selection. Cell suspensions transferred to a 50[degrees]C rotary shaker water bath exhibited a rapid rise in media temperature within the flask (Fig. 2). Flasks with an initial temperature of 25[degrees]C reached 40[degrees]C within 1 min of heat treatment. The flask temperature rose to 46[degrees]C after 3 min of heat exposure and then gradually increased to 49[degrees]C over the next 27 min. Analysis of embryo recovery following the 5, 10, 20, 30, 45, and 100 min heat exposure showed 16 embryos recovered after a 5-min exposure, 2 after a 10-min exposure, 2 after a 20-min exposure, and no embryos recovered following the 30-, 45-, or 100-min exposures. The effectiveness of the 5-min heat exposure was further studied using 11 cell suspension cultures. Following the 5-min heat exposure, each culture was analyzed with six of the 11 cultures failing to provide any viable embryos, four producing two embryos per culture, and one culture generating 10 embryos. All of the recovered embryos were shown to be transgenic via PCR analysis. Although selection for transgenics was successful, the procedure required too much processing time between each sample to make this a viable method for high throughput. Because of the time required to remove the heated media, replace it with 25[degrees]C media and then plate embryonic suspension cultures following the heat treatment, we chose to evaluate heat selection following transfer of the embryonic suspension cultures to solid MSK media.

Determination of the optimal heat selection temperature for MSK media. Initial studies evaluated embryo survival following a 150- min exposure to chamber temperatures of 30, 44, 46, 48, 50, and 52[degrees]C. The internal Petri dish temperatures were found to be 30, 39.7, 42.6, 44.7, 46.1, and 49[degrees]C, respectively. The average number of viable embryos per Petri dish following the heat treatments showed an increase in embryo survival following the 39.70C treatment compared with the 30[degrees]C control (Fig. 3). Mean embryo numbers declined following the 42.6, 44.7 and 46.10C treatment to 2.6, 1.7, and 0.1 embryos per plate, respectively. No viable embryos were observed following the 49[degrees]C treatment. Subsequent experiments were performed using the 46.1 internal temperature (50[degrees]C incubator setting). To better understand the rate of temperature change within the Petri dishes incubated in the 50[degrees]C chamber, the Phytagel surface temperature was measured every 5 min throughout the 150-min incubation (Fig. 4). Petri dish temperatures increased from the 26[degrees]C initial temperature to 46 to 47[degrees]C over the first 80 min of incubation. Internal Petri dish temperatures remained between 46 and 47[degrees]C from 80 to 150 min of incubation.

Figure 2. Time course of temperature in cell suspension cultures shaken in a 50[degrees]C water bath.

Figure 3. Cotton embryo survival following heat treatment in an incubator set for 30, 44, 46, 48, 50, or 52[degrees]C for 150 min immediately following transfer of embryogenic cell suspensions to MSK plates. Final plate temperatures were 30, 39.7, 42,6, 44.7, 46.1, and 49C, respectively.

Selection on MSK media. Of 172 heat-treated (incubator @ 50[degrees]C) plates, 75 developed one or more embryos. Figure 5 shows the distribution of embryo production on non-treated and heat- treated plates. Control plates (Fig. 5, open bars) exhibit a normal distribution of embryo production, with an average of seven to 10 embryos per plate and a maximum of 19 embryos on two of the 56 control plates analyzed. The 172 plates that had experienced the heat challenge exhibited a very different pattern of embryo generation (Fig. 5, solid bars). The distribution of embryo production exhibited an exponential decay with most plates having no or only a few embryos. There were eight plates having 21 or more embryos, with a maximum of 33 embryos developing on one of the plates. Figure 6 shows the results of PCR screens for the introduced SuperPromoter::hsp101 (Fig. 6B) and NPTIJ (Fig. 6C) genes within treated and untreated plant material. All of the heat-selected embryos tested from a single cell line (a cell line represents suspension culture derived from callus originating at a unique site on the co-cultivated hypocotyls) contained the SuperPromoter::hsp101 transgene (Fig. 6B), while only one of seven embryos from the non- selected material showed the presence of the introduced gene. Figure 6C shows the polymerase chain reaction (PCR) results of the presence of the co-transferred NPTII gene from a second, independently selected cell line. Lanes 26-36 are from embryos that survived a 150- min heat treatment while lanes 4-23 are from embryos treated identically, but without the heat selection step. The PCR results indicated that 10 of 11 heatselected embryos contained the introduced NPTII gene, compared to only one of 19 embryos from the non-treated embryos.

Figure 4. Time course of temperature increases on the solid medium during selection in a 50[degrees]C incubator.

Figure 5. The frequency distribution of the number of embryos on non-treated (NT) and heat-treated (HT) plates.

The small amount of DNA available from individual embryos prevented direct confirmation of transgene integration into the plant genome. However, several heatselected embryos were maintained in sterile culture and developed into viable cotton seedlings. Leaf tissue from R^sub 1^ progeny of individual seedlings from four independently grown and selected cell lines was subsequently tested for the presence of the SuperPromoter::hsp101 construct using PCR primer sets targeting both the 5′ promoter: :hsp 101 and 3′ hsp::terminator junctions of the hps101 construct (Fig. 7). Transgene segregation ratios for all of the lines were consistent with single locus transgene integration (not significantly different from predicted ratios with 95% confidence via chi-square test) and none contained DNA targeted by primers for the non-transferred A. tumefaciens VirD4 region of the Ti plasmid, an indicator of bacterial contamination.

The efficiency of the selection procedures described in this study were high, with the cell suspension treatment producing only transgenic embryos and the plate selection procedure generating nine transgenics from the 10 surviving embryos.

Discussion

This study investigated the use of thermal protection provided by constitutive expression of hsp01 as a means of selecting transgenic cells and embryos. Previous research showed that plants constitutively expressing hsp101 tolerated sudden shifts to extreme temperatures better than did vector-only controls (Queitsch et al. 2000). The authors concluded that hsp101 plays a pivotal role in heat tolerance in Arabidopsis. Given the high evolutionary conservation of this protein and the fact that enhancing hsp101 expression had no detrimental effects on normal growth or development, they suggested that one should be able to manipulate the stress tolerance of other plants by altering the production of this protein.

Considering the crucial role of hsp101 in imparting thermotolerance to cells, (Katiyar-Agarwal et al. 2003) introduced Athsp101 cDNA into the Pusa basmati 1 cultivar of rice (Oryza sativa L.). Stable integration of the transgene into the rice genome and subsequent expression was demonstrated by Southern, northern, and western blot analyses. They reported no adverse effect of overexpression of the transgene on overall growth and development of the transformants. Genetic analysis of tested T1 lines showed that the transgene segregated in a Mendelian fashion. Comparison of T2 transgenic lines with the untransformed control plants showed that the transgenic rice lines displayed significantly better growth performance in the recovery phase following high temperature stress. This thermotolerance advantage appeared to be directly caused by overexpression of the Athsp101 transgene as neither the expression of endogenous low-molecular-weight heat shock proteins (HSPs) nor of other members of Clp family proteins were found to be altered in the transgenic rice.

The effect of heat shock on the growth of cultured sugarcane cells (Saccharum officinarum L.) was measured by Moisyadi and Harrington (1989). Heat shock (HS) treatment at 36[degrees] to 38[degrees]C (2 h) induced the development of maximum thermotolerance to an otherwise non-permissive heat stress of 54[degrees]C for 7 min. Optimum thermotolerance was observed 8 h after the sublethal heat shock. Temperatures above 40[degrees]C failed to induce maximum thermotolerance and resulted in progressively decreased HSP synthesis. Figure 6. PCR analysis for the presence of the introduced HSP 101 and NPTII genes in embryos incubated at either normal or elevated (selecting) temperatures. (A). Diagram of SuperPromoter::hsp101 construct indicating primers used for PCR screening (open arrowheads). (B). PCR results using primer set P-Ags-> vs HSP101-5′<(product = 277 bp); lanes 1-3, DNA from the indicated control transgenic plants (0 is a no template control); lanes 4 thru 10, DNA from untreated embryos; lanes 17 thru 23, DNA from heat-selected (150 min at 46-47[degrees]C) embryos. (Q. PCR results using primer set NPT2-> vs NPT2<- (product = 414 bp); lanes 1-3 are identical to the control samples used for part B, lanes 24 and 25 used DNA from transgene positive (26) negative (25) plants generated during a previous heat-selection of 1802-HSP transgenic plants; lanes 4 thru 23, DNA from untreated embryos; lanes 26 thru 36, DNA from heat-selected (150 min at 46- 17[degrees]C) embryos. DNA ladder used: 2, 1.5, 1, 0.7, 0.5, 0.4, 0.3, 0.2, 0.1 kb.

We have capitalized on the enhanced cellular heat tolerance provided by hsp101 overexpression to directly select for transgenic cells and embryos produced by A. tumefaciens genetic transformation. Our initial analysis of selection at the cell suspension level showed that liquid cultures with an initial temperature of 25[degrees]C reached 46[degrees]C after 3 min of heat exposure (50[degrees]C), a shift that appeared to be too rapid for optimal heat shock induction of thermotolerance, and was not likely to allow effective development of the level of thermotolerance described by Moisyadi and Harrington (1989). Analysis of embryo survival following the heat exposure showed 16 embryos recovered after a 5- min exposure, 2 after a 10-min exposure, 2 after a 20-min exposure, and no embryos recovered following the 30-, 45-, or 100-min exposures. Although the level of embryo recovery after heat treatment of the liquid cultures was poor, PCR analysis of the embryos that developed showed that all contained the hsp101 transgene. Selection in liquid culture was further complicated by the extent of time and effort necessary to remove the warm cell suspension medium from flask of heat-treated cells, wash the cells with 25[degrees]C medium, and then transfer the cells to MSK plates for subsequent embryogenesis.

Figure 7. PCR analysis for segregation of the HSP 101 transgene in heat-selected R^sub 1^ transgenics. (A). The segregation ratio of PCR positive (transgenic) to PCR negative (wild type) for R^sub 1^ plants from four independently transformed and selected cell lines is presented. Data for all four lines were not significantly different from predicted ratios (single transgene locus) with 95% confidence (chi-square test, n=21-23, with one degree of freedom). (B). Example electrophoresis results from all PCR primer sets used (results from eight representative R^sub 1^ plants from one line are shown): CelSyn (cotton cellulose synthase to confirm DNA PCR competency); HSP101-3′ (hsp101-3′::terminator junction); HSP101-5′ (promoter::hsp101 5′ junction); and VirD4 (testing for possible A. tumefaciens contamination of plant samples). DNA controls for each primer set are: negative PCR control “0″ (no template added to PCR reaction), and positive PCR control, “At” (total DNA from the A. tumefaciens line, pE1801-hsp101, containing the hsp101 construct and Ti plasmid VirD4).

To enhance the rate of embryo recovery and simplify throughput during selection of transgenics, a procedure was developed that evaluated the tolerance of heat-treated cells and embryos on solid media (MSK plates). The procedure described in this study allows the simultaneous challenge of 150 to 200 sample plates, representing many hundreds of potential embryos. The data shown in Fig. 5 indicate that some treated Petri dishes failed to show an obvious reduction in embryo numbers when compared to unheated control plates. The plate-to-plate variability in the effectiveness of the heat selection may in part be related to the use of three shelves within the incubator for the heat treatment. Likely variation in temperature and heat transfer within and between shelves may explain the observed differences in heat treatment effectiveness. Another possible contributing factor is variability in media thickness among the plates that could alter the rate of heating between Petri dishes. Despite the variability from plate-to-plate, overall the procedure was quite effective in enhancing the percentage of transgenic embryos.

Transformed embryos were grown to maturity, and progeny were analyzed for the stability of the transformation events. Transformants showed classical Mendelian genetics for the HSP 101 allele, and homozygous transformants were obtained through standard genetic screening. Despite low efficiency, heat treatment of cell suspension cultures provided a more efficient selection then heat treatment of cells and embryos on MSK solid media. Depending on the requirements of the research program, one could use the cell suspension method to obtain transgenic embryos with high selection efficiency, or the MSK plate treatment to obtain greater numbers of transgenic lines, with up to 90% of the embryos containing the desired transgene. We believe that the efficiency of the MSK plate selection procedure could be enhanced by the use of incubators with more even heat distribution than that used in the present study, and by using a monolayer of MSK plates rather than stacking the plates. Clearly, these procedures allow for the selection of transgenic cells and embryos without the use of antibiotics.

Received: 7 March 2007 /Accepted: 19 March 2008 /Published online: 2 July 2008 / Editor: Charles L. Armstrong, Ph.D.

(c) The Society for In Vitro Biology 2008

Acknowledgments The author thanks Jacob Sanchez, Marie Syapin, Brian Sanderson, and Dee Dee Laumbach for their excellent technical assistance. Mention of a commercial or proprietary product does not constitute an endorsement by the USDA. USDA offers its programs to all eligible persons regardless of race, color, age, sex, or national origin.

References

Bayley C.; Trolinder N.; Ray C.; Morgan M.; Quisenberry J. E.; Ow D. W. Engineering 2,4-D resistance into cotton. Theor. Appl. Genet. 835: 645-649; 1992.

Bretagne-Sagnard B.; Chupeau Y. Selection of transgenic flax plants is facilitated by spectinomycin. Transgenic Res. 5: 131-137; 1996.

DeBlock M.; Botterdam J.; Vanderwiele M.; Dockx J.; Thoen C.; Gossele V; et al. Engineering herbicide resistance in plant by expressing a detoxifying enzyme. EMBO J. 6: 2513-2518; 1987.

DeBlock M.; Brouwer D. D.; Tenning P. Transformation of Brassica napus and Brassica oleracea using Agrobacterium tumefaciens and the expression of the bar and neo genes in the transgenic plants. Plant Physiol. 91: 694-701; 1989.

Fraley R. T; Rogers S. G.; Horsch R. B. Genetic transformation in higher plants. Crit. Rev. Plant Sci. 41: 1-46; 1986.

Fromm M. E.; Morrish F.; Armstrong C.; Williams R.; Thomas J.; Klein T. M. Inheritance and expression of chimeric genes in the progeny of transgenic maize plants. Biotechnol. 8: 833-839; 1990.

Gamborg O. L.; Miller R. A.; Ojima K. Nutrient requirements of suspension cultures of soybean root cells. Cell Res. 50: 151-158; 1968.

Hille J.; Verheggen F.; Roelvink P.; Franssen H.; Kammen A. v.; Zabel P. Bleomycin resistance: A new dominant selectable marker for plant cell transformation. Plant Mol. Biol. 73: 171-176; 1986.

Hood E. E.; Gelvin S. B.; Melchers L. S.; Hoekema A. New Agrobacterium helper plasmids for gene transfer to plants. Transgenic Res. 2: 208-218; 1993.

Jayne, S.; Barnour, E.; Mayer, T. Methods for improving transformation efficiency. U. S. Patent 6,096,947. 2000.

Jones J. D. G.; Svab Z.; Harper E. C.; Hurwitz C. D.; Maliga P. A dominant nuclear streptomycin resistance marker for plant cell transformation. Mol. Gen. Genet. 210: 86-91; 1987.

Katiyar-Agarwal S.; Agarwal M.; Grover A. Heat-tolerant basmati rice engineered by over-expression of hsp101. Plant Mol. Biol. 51: 677-686; 2003.

Li Z.; Murai N. Agronomic trait evaluation of field-grown transgenic rice plants containing the hygromycin resistance gene and the maize activator element. Plant Sci. 108: 219-227; 1995.

Lindquist, S. Methods and compositions of genetic stress response systems. U. S. Patent 5,827,685. 1998.

Meijer E. G.; Schilperoort R. A.; Rueb S.; van Os-Ruygrok P. E.; Hensgens L. A. Transgenic rice cell lines and plants: Expression of transferred chimeric genes. Plant Mol. Biol. 16: 807-820; 1991.

Moisyadi S.; Harrington H. M. Characterization of the heat shock response in cultured sugarcane cells: I. Physiology of the heat shock response and heat shock protein synthesis. Plant Physiol. 90: 1156-1162; 1989.

Murashige T.; Skoog F. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant 15: 473497; 1962.

Ni M.; Cui D.; Einstein J.; Narasimhulu S.; Vergara Q.; Gelvin S. Strength and tissue specificity of chimeric promoters derived from the octopine and mannopine synthase genes. Plant J. 7: 661-676; 1995.

Nover L.; Scharf K. D. Heat stress proteins and transcription factors. Cell. Mol. Life Sci. 53: 80-103; 1997.

Queitsch C.; Hong S. W.; Vierling E.; Lindquist S. Heat shock protein 101 plays a crucial role in thermotolerance in Arabidopsis. Plant Cell 12: 479-492; 2000.

Schoffl F.; Prandl R.; Reindl A. Regulation of the heat-shock response. Plant Physiol. 117: 1135-1141; 1998.

Toki S.; Takamatsu S.; Nojiri C.; Ooba S.; Anzai H.; Iwata M.; et al. Expression of a maize ubiquitin gene promoter-bar chimeric gene in transgenic rice plants. Plant Physiol. 100: 1503-1507; 1992.

Vierling E. The roles of heat shock proteins in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 42: 579-620; 1991. Waldron C.; Murphy E. B.; Roberts J. L.; Gustafson G. D.; Armour S. L.; Malcolm S. K. Resistance to hygromycin B. A new marker for plant transformation studies. Plant Mol. Biol. 52: 103-108; 1985.

Walker-Peach C.; Velten J. Agrobacterium-mediated gene transfer to plant cells: Cointegrate and binary vector systems. In: Gelvin S. B.; SchilperoortR. A.; VermaD. P. S. (eds) Plant molecular biology manual. Kluwer Academic Publishers, The Netherlands, pp 1-19; 1984.

Xin Z.; Velten J. P.; Oliver M. J.; Burke J. J. High-throughput DNA extraction method suitable for PCR. Biotechniques 34: 820-824, 826; 2003.

Zimmerman, J. L.; Slovin, J. P.; Malik, M. K. Thermotolerance enhancing protein. U. S. Patent 5,922,929. 1999.

J. J. Burke (*) * J. Velten

USDA Plant Stress and Germplasm Development Unit,

3810 4th Street,

Lubbock, TX 79415, USA

e-mail: John.Burke@ars.usda.gov

J. Velten

e-mail: Jeff.Velten@ars.usda.gov

P. J. O’Mahony

Food Safety Authority of Ireland,

Abbey Court, Lower Abbey Street,

Dublin 1, Ireland

e-mail: PJOMahony@fsai.ie

M. J. Oliver

USDA Plant Genetics Research,

205 Curtis Hall, University of Missouri,

Columbia, MO 65211-7020, USA

e-mail: Mel.Oliver@ars.usda.gov

Copyright Society for In Vitro Biology Jul/Aug 2008

(c) 2008 In Vitro Cellular & Developmental Biology; Plant. Provided by ProQuest LLC. All rights Reserved.