Identification and Authentication of Animal Cell Culture By Polymerase Chain Reaction Amplification and Dna Sequencing
Posted on: Saturday, 22 May 2004, 06:00 CDT
SUMMARY
Polymerase chain reaction (PCR) amplification and deoxyribonucleic acid (DNA) sequence analysis were used to identify the species origin of cell lines used in a cell culture facility where various cell lines of different species are routinely propagated. The aldolase gene family was selected for PCR amplification because the DNMA sequences of this gene are highly conserved over a wide range of animals and humans. A total of 36 cell lines representing 13 different species were selected for this study. The DNA from each cell line was amplified, and PCR products were analyzed by agarose gel electrophoresis. The results showed unique profiles of amplified bands on agarose gels that allowed differentiation among non-closely related species. However, DNA amplification of closely related species, including rat and mouse or human and primate, resulted in similar and indistinguishable banding patterns that could be further differentiated by DNA sequence analysis. These results suggested that aldolase gene amplification coupled with DNA sequence analysis is a useful tool for identification of cell lines and has potential application for use in identification of interspecies cross-contamination.
Key words: cell culture; authentication; PCR; DNA sequencing.
INTRODUCTION
Cell lines are valuable tools for research and diagnostic applications as well as for the production of biological products including vaccines and anlmodies. ldentification or authientication of the origin of cell lines is an essential part of the quality- control guidelines established by Food and Drug Administration regulations (Zoon, 1993; Sheets, 2000). Identification of cell lines is performed for the purpose of identifying die species of origin. Authentication will not only identity die species origin of each cell line but will also detect any cross-contamination with other species. Two major potential problems associated with propagation and maintenance of a large number of cell lines include misidcntilication and cross-contamination. Therefore, it is imperative to routinely monitor cell lines for identity and authenticity. Several techniques have been developed to identify the origin of animal cell lines including enzyme (allozyme and isoenzyme) analysis (O'Brien and Shannon, 1980), karyotypo analysis (licit, 1995). and deoxynbonucleie acid (DNA) fingerprinting (Slacey et al. 1992a; Malsuo and Nishizaki, 1999). Enzyme and karyolype analysis techniques are still widely used for this purpose (Belt, 1995: Hay and Miranda-Cleland, 2000). However, these techniques require well-trained and experienced personnel and have proved not to be cost-edcetive. Such (actors also make these techniques impractical for quality control and authentication of cell lines (Stacey et al., 1992b; Doyle and Griffithes, 2000). Stacey et al. (1997) used polymerase chain reaction (PCR) amplification of the aldolase gene to authenticate animal cell lines because aldolase genes arc highly conserved over a wide range of mammalian species. A set of universal primers derived from the aldolase gene family has been used to target a wide range of animal species (Lessa and Applebaum, 1993). The exons of aldolase genes of all known vertebrates are split by introns at precisely the same position. In addition, the DNA sequence of each exon is highly conserved, whereas the introns vary in size and sequence among animal species. Primers used by Stacey et al. (1997) encompass the conserved segment of exon and a target region of intron for three aldolase genes. The multiple loci can he amplified simultaneously by PCR reaction depending on primer affinity to each locus using a single, set of primers (Lessa and Applebaum, 1993). The aim of this study was to use the aldolase primers to identify the origin of individual cell lines and Io detect any crossculture contamination in continuously cultured animal cell lines by PCR amplification coupled with DNA sequence analysis.
MATERIALS AND METHODS
Cell line selection and culture. A total of 36 cell lines from 13 different species were selected for this study (Table 1). All cell lines were selected from the Centers for Diseases Control and Prevention (CDC) cell repository. Authentication of the cell lines used for routine production at CDC was performed by the Cell Culture Laboratory. The Michigan Children's Hospital, by karyotypc and isocuxyme analyses. The cell lines used in this study were tested for niycoplasnia and other bacterial contamination as previously described (Pruckler and Pruckler, 1995).
Cells were propagated at 37 C svith 5% CO2, Each cell line was propagated using appropriate base tissue culture media (GIBCO-Life Technology, Carlsbad, CA) supplemented witIi 5-10% fetal bovine serum (HyClone, Logan, UT). Other cell culture medium supplements including sodium pyruvate and nonessenliai aniino acids were added In some cell lilies as recommended by American Type Culture Collection (ATCC).
TABLE l
CKU. LINKS EVALUATED KRU POUYMKRASE CHAIN HKACTION AMPUKICATION USING AUOUASK GIiNK PKIVIKKS
FIG. 1. The PCK amplification of DiNiA from 26 various cell hues representing 13 (liflcrctil species. Amplified DNAs were anaKled by 1.5% afiarose fiel electrophoresis as described m lhc Materials and Melliods. Tie DNA profiles indicate a pair of cell lines representing the same species except lane 25. Whlch represents only one cell line. Ceil lines included piji. lanes I and 2: rabbit, lanes 3 and 4: guinea piji. lanes 5 and 6cou. lanes 7 and 8; human. ltines 9 and 10; monkey, lanes Il and 12; dou. lanes 18 and il: mouse, lancx 15 and 16; rat. lanes 17 and 11; hamster, lanes 11 and 20; sheep, lanes 21 and 22: cat. lanes 21i and 24: horse, lane 2.1 (only one cell line). Molecular sizc standards are shown on the IeJi. IH.Ii. polvmcrasc chain reaction; DNA. dcoribonucieic acid.
Deoxyribofiuclcic acid pn'ixiralion. Cells (5 10^sup 6^) were, washed twiee with 0.01 M phosphate-buffered saline. pH 7.4. and ecntriiuged at 1000 rpm at room temperature. Cell DNA was extracted using QIAamp I)NA Mini Kit Spin Column (Qiagen) (Valencia, CA). as descril)ed by the manufacturer. The DNA concentration of each preparation was estimated by optical density at a wavelength of 200- 280. as described in the QIAamp DNA Mini Kit Handbook.
Potymerase chain reaction. The aldolase primers ALDl (TGTGCCCAGTATAAGAAGGATGG) and ALD2 (CCCATCAGGGAGAATTTCAGGCTCCACAA) and PCR reaction conditions used were similar to those described by Lessa and Applebaum (1993). Each PCR reaction contained a total volume of TOO l containing 1.5 mM MgCIg, 200 l deoxynueleoside triphosphate, 2.5 units Tbc DNA polymerase, 20 picomoles of each aldolase primer, and 100 ng cellular DNA templates. Taq PCR master mix kit was used for PCR reactions (Qiagen) (Valencia, CA). Aldolase primers were produced by the Biotechnology Core Facility Branch, CI)C. The PCR reaction was performed for 35 cycles under the following conditions: 95 C for l min, 57 C for 45 s, and 72 C for l min. The PCR products were analyzed by 1.5% agarose gels in TBE buffer (1 M Tris, 0.9 M boric acid, and O.OI M ethylenedinminetetraacetic acid), followed by staining with ethidium bromide. A 100-bp DNA standard (New England Bio-Lab, Beverly MA, USA) was used as molecular marker.
Deoxyribonticleic acid sequencing. Alter PCR amplification. I)NA from mouse, rat. human, and monkey cell lines was further analyzed by I)NA sequencing. The amplified I)NA bands of IHO bp from mouse and rat cell lines as lell as amplified DNA bands of 500 bp from human and primate eell lines were extracted from the agarose gels using a Ciaquick Gel Extraction kit (Qiagen). The DNA sequencing was performed with the ABI PRISM Big Dye Terminator Cycle Sequencing Core Kit (Applied Biosyslems) (Foster City, CA) using aldolase primers. The DNA samples were dried by a vacuumcentrifuge drier without heat. The I)NA samples were then resuspended in 25 l of lenilile suppression reaenl in O.2-ml sequencing lube, henled at 95 C for 3 min. and chilled at 4 C. The sequencing lubes were placed in a 310 genetic capillary clectrophoresis a mil yer (Applied Biosystenis), and DNA sequencing was performed for 1-2 h according to the manufacturer's instructions. The DNA sequence data were then analyzed using the Gene Jockey (Biosoft) (Cambridge, UK) software.
RESULTS
A tolal of 36 cell lines representing 13 species were studied (Table 1). Tbe selected cell lines were previously tested by isoenvine analysis, species-specific immiinofliiorcsccnce, and eylogenelic analysis. Aldolase primers used in lliis slndy were designed by Lessa and Applebaum (1993) Io target lhe inlron regions ol lhree aldolase genes and Io amplify ninlliple loei. Agarose gel analysis oi DNA fragments indicated that one to lour amplified INA bands were detected depending on die eell species analyzed. 'Hie molecular size of I)NA fragments detected ranged from 150 to 550 bp as shown in Fig. I. Amplification of I)NA from cell lines of rabbit, cow, horse, guinea pig, and pig origin resulted in lhe detection ol a single band of varying molecular sixe. whereas the amplifications oi DNA of die oilier eighl species (human, monkey, mouse, rat, sheep, clog, cul, and hamster) resulted in diedeleelion of mulliple bands. Of the species with multiple bands, with lhe exception of the sheep cell line, one oi the I)NA hands was found Io be more intense lhan lhe other hands (Fig. I). The number of visible NA bands with their estimated molecular sizes lor each ol lhe 1-I species analyzed is shown in Table 1. The amplified DNA profiles were found to be similar within each species bill dillcrenl from oilier speeies, indicating that species could be differentiated from one another based on the sice and nuinhrr of amplified I)NA fragments. However, the MUmI)(M' and sice of I)NA bands when compared from human and monkey cells as well as lroiu mouse and rat cell MICS were similar. Two DINA fragments of 300 and 500 bp were delected when IHIMUIM and monkey cell hues were amplified. .Amplification of mouse and rat cell hues resulted in lour DMA hands with molecular sixes of 180, 300, 490, and 510 bp.
FIG. 2. The PCR amplification of DNA nun one imkmmn lane Z VTCAA CKI-6297) and two known (lane I. clone-9): lane 3. NHK-49] rai cell lint Amplified DNAs wcre nalyzed by 1.5% agarose gel (dectroplioresis as deerihed In the Materials and Methods. The sizc of lour amplified DNA IVameiils is shown nn nilit. Slandard nioleeular markers are indicated on left. PCR. polymerase chain reaction: DNA deorilninnclcie acid.
FIH 3. Identification ol the origin of cell line IW. The PCK amplification of DNA from one unknown (ltinc I. W)] and one knouri (lane 2. mouse S/P 20) cell lines. Amplified DNA uas analyzed by 1.5% agarose gel eleclrophoresis as dect'ihed in lie Malcnals and letliods. The results indicate thai the DNA profile of cell line IiO (lane I) was similar Io thai of S/P 20 mouse cell line (lane 2). PCR polymerse chain reaction: DNA, deoll rihonncleic acid.
FIG. 1. Tlic DiNA micleolide sequence analysis ol three mouse cell lines (fanes 2 and 9 McCov: lanes 3 and K). Kau; lanes -4 and 11, 2011) and lhreo ral cell liiic (lanes 5 and 12 ATCC CKI,-0297: lanes 6 and 13, cloneV: lanes 7 and 14. NKk-I1). A DNA fragment ol' 180 bp amplified from each cell I me u as sequeneed as desenhed m I he Materials and M el hods. Partial DNA sequences (hpanninr from Kt Io L'iO iiueleiiiides) obtained from each sample uere aliened, - lrrotcs indicate die positions ol three nneleotide changes (T Io C. (i to A. and T Io (C) beluei-n mouse and ral cell lines, Lsines I and 8 (contig. #1 ) represent contiguous uueleohde seijiience .spanning; lrom H) Io 130 nucleoiides. PCK, poKmerase cliain reaelion: DYA. deoxyriboiiueleic acid.
FIG 5. The DNA nueleolide sequence analysis ol live human cell lines (ftines 2 and 11, ULK: lanes 3 and 12. a549: hues 4 and 13. 11202: lanes 5 and 14 RD): lanes 6 and 15. I1KP2C) and tliree monkey cell lines (lanes 7 and If). UCM; lanes nml IT. BSC-10 lanes 9 and 18 E-6 A PCR NA fragment of 500 hp amplified lroni each cell line was seilncnced as desenlxnl in the Materials and Methods. Partial DNiA sequences (spanning lroin 80 to 210 nitclentides) ohtained I'roni each sample uere aliened. The aliened I)INA se(nenees (spanning 80-2 1(1 nncleolides) nniicale nui]or nncleolide varuttions ainon monkey ami liinnan cell lines, lioxcd DNA seiienccs represent monkey cell lines, and anhoxed DNA seliienees represent human cell lines. Lanes I and H) (eoriti. #1) represent contiguous nncleolide seuenee spatininji 80-210 nncleolides. PCH. poKmcrasc eliain reaction: DNA, deoxyrihomicleic acid.
Although the sixs of IIVV fragments from gel eleetrophoresis was similar IM human and sheep, unknown sheep and human cell linos Were easily identified when known human or sheep cell lines were used as positive controls.
The PCK amplification was also used to identity cell lines of unknown origin. A cell line ( VTCC CRL-6207), originally recorded as a monkey C(M1I line, was analyxcd using the aldolase primers. The results revealed four amplified I)IVV fragments of 180. 390. 450, and 510 bp. Because a similar I)NA profile was observed with two different rat cell lines (Fig. 2), the results suggested that the unknown cell line was ol a rodent origin. One additional unknown cell line (BO) was also analyzed. The profile ol amplified DNA fragments shown in Kig. 3 indicated that this C(M1I line was ol mouse origin.
Amplified I)NA products from human. monkey. mouse, and rat were further analyed by DNA sequencing using aldolase primers as described in the Materials ami M el lux Is. Tlie DNA seqneice analysis ol a IH-bp amplified DNA from three mouse 1II hues (Mcoy, 1,2OB, and Haw) and lhree rat cell lines (ATCC CHL-6297, elone-9, and NHK-IO) is slunvn in Figur. 4. The results indicalcd lhal DNA sejuences of rat and mouse origin varied predominant Iy at three positions (T to C, C Io A. and T to C). The DNA sequence analysis also confirmed the PIK results that the ATCC 6297 cell line (Fig. 2) is a rat cell hue (Kig. L lane 4). Furlliermore. DNA sequence analysis of a 500-bp fragment from five human cell hues (HLK A549. 11292, HI), and I1KP2C) and three monkey cell lines (K-6. BCM, and BSC-40) revealed numerous differences with few similarities bctwcen human and monkey cell lines aldolase nueleotide sequences as shown in IM. Fig 5.
DlSCLSSIOiS
The cell culture (acuity at CIC in Atlanta, Georgia, has a repository of more lliun 530 cell lines representing 20 different species. Cell authentication is important to maintain the integrity of research studies using these cell lines. In this study, we have used a PCR amplification assay using a single set of aldolase primers to analyze 36 cell lines representing 13 different species. The aldolase gene family of eukaryotes contains three genes (A, B. and C), which are located on separate chromosomes. The primer pair used in this study targets I)OlIi the conserved exon region and a portion of the inlron regions of aldolase genes. Multiple loci from a single species could he amplified simultaneously by PCR depending on the primer affinity to each locus (Lessa and Applebaum, 1993). The results of I)NA gel analyses showed that amplified DNA fragments varied in number and molecular sixe. Hy using aldolase gene primers, sve were able to differentiate the origin of all cell lines tested including rabbit, pig, horse, guinea pig. cow, sheep, dog. cat. and hamster cell lines (Fig. 1). In addition, by using D.NA sequence analysis, it is possible to further differentiate between rat and mouse as well as monkey and human cell lines. Amplified DNA fragments from various cell lines were differentiated mainly by the size and number of DNA bands observed by agarose gel electrophorcsis. Currently, attempts arc being made Io furtlicr distinguish between human and monkey cell bues by developing new primers. In addition, the experiments are underway to determine whether this PCR method can be used to differentiate mixed coll lines.
The results of P(JR amplification and DNA sequence analyses indicated thai one cell line (ATCC CRL-6297) that had been originally recorded as a monkey cell line xsas actually of rat origin (I'igs 2 and 4). These results svcrc further substantiated by karyotype analysis and species-specific immunofluorcscciice reactions (data not shown). Several additional cell lines of unknown origin from our cell line repository were also studied. The PCR analysis enabled classification of these cell lines into distinct individual species. An example is shown in Fig. 3. The cell line H9 with previously unknown origin was identified as a mouse cell line (Fiig. 3. lane 1) when compared with the control mouse SP2/0 cell line (Fig. 3. fie .2). The DMA sequence analysis further substantiated that this cell line was of a mouse origin (data not shown).
Conventional methods for cell line identification including eytogenetic analysis, species-specific immunofluorescence, and enzyme analysis are expensive, lime-consuming, and often require experienced personnel Io perform. Tlie aldolase PCH melliod is a significant improvement over conventional metliods because it is inexpensive, fust, and requires a minimum training for laboratory personnel to perform. Kven though I)NA sequencing allowed dillerenliation of monkey from human and mouse lrom rat cell lines, our results indicated that the remaining nine cell lines could be differentiated by FOR amplification.
AOKNOWLEDGEMENT
We thank Dr. Carolyn lilack lor her crilical rcviru ol lho manuscript.
REFERENCES
Belt. A. Charaeteriztinn ol culture used hit- biotechnology and industry. In: Hunter-Cevera. J. C.: Belt. A.. cd. Maintaining cultures fur biotechnology and industry. Academic Press: I 995:25 1- 258 (San Diego. CA).
Doyle. A.: GrilTithes. J. B. Identity testing-an mervicw. In: Doyle. A.: Crifflthes. .1. B.. ed. Cell and tissue culture for medical research. John Wlev A Sons: 2000:75-78. Oxford. I K.
May. R. J.: Miranda-Cleland. Vl. C.ell line presenalion and authentication. In: Masters. J. Ii. Vt.. ed. Animal cell cullure: a practical approach. 3rd. Oxford t nicrsily Press; 20078-fi8 Oxford. I k.
Kessa. K. P Applebamn. G. Screening techniques lor detecting allelic ariation in DNA sequences. VIoI. Kent 2:119-129; 1993.
Matsuo, Y.: Nislnhki. C1. Kflieienl ADA fingerprinting method loi the identification ol cross-culture contamination ol cell lines. Hum. Fell 12(3): 149-151: IW.
O'Brien. S. J.: Shannon. J. K. A molecular approach Io the identification and individualizalion ol human and animal celU in culture: isoxme and alloyme genetic signature. In flro l(2):l 19- 135: 1980.
I'ruckler. M. J.: Pruckler. M. .1. Detection In poK morase chain renelinn of all common Myeoplasma in a cell culture faeililx. I'alholiiology 635:11-I I: IW5.
Sheets, K. History and chai-acleric.alion of the gero cell line. A rehiorl In Kelieeca Sheets. Kockville. Ml): Center lor Biologies Klaliialion and Research. l-Ooii and Drug Administration: 2000.
Staeey. G. N.: Bollon. B. J. Multilocus DA lingerprinling analysis of cellbank: stability studies and culture identification in hu\man li-lymphoblasloid and mammalian cell lines. Cy lnleehnolngy 8:.1-20: 1992a.
Staeey. C. N.: Bolton. B. J. DNA (ingerprinling transforms the art of cell authentication. Nature 357:261-262: I992b.
Staeey. G. N.: lloelkl. H. Aulhenlieation ol animal cell cultures by direct visualivation of repjtilie DNA. aldolase gene I'CK and isoensme analysis, liinlngicals 25:75-II5: 1997.
ZllU K. C. Points Io consider in the characlerization ol cell lino used to produce biologicals. Kockville. VII): Center lor Biologies EWvaluation and Kesearch. I'Dod and Drug Administration: 1993:7-8.
MERRY Y. LIU,1 SEH-CHING LIN, HSI LIU, FRANCISCO CANDAL, AND ABBAS VAFAI
Biologics Branch, Scientific Resources Program, National Center for Infections Diseases, Centers for Disease Control and Prevention, 1600 Clifton Road, MS-D43, Atlanta, Georgia 30333 (M. Y. L., S.-C. L., F. C., A. V.) and Division of AIDS, STD, and TB Laboratory Research, National Center for Infectious Disease, Centers for Disease Control and Prevention, Atlant, Georgia 30333 (H. L.)
(Received 19 November 2003; accepted 28 January 2004)
1 To whom correspondence should be addressed at E-mial: mk16@cdc.gov
Copyright Society for In Vitro Biology Nov/Dec 2003
Related Articles
- Acmnpv in Permissive, Semipermissive, and Nonpermissive Cell Lines From Arthropoda
- Panel Says Scientist Faked Stem Cell Lines
- Gemcitabine Inhibits Viability, Growth, and Metastasis of Osteosarcoma Cell Lines
- New Study Shows Embryonic Stem Cell Lines Classified By 'MicroRNA' Expression
- Baculovirus-Based Expression of an Insect Viral Protein in 12 Different Insect Cell Lines
- Asterand to Distribute University of Michigan Breast Cancer (SUM) Cell Lines
- The DHE Cell Line As a Model for Studying Rat Gastro-Intestinal Mucin Expression: Effects of Dexamethasone
- Establishment and Characterization of Cell Lines From 3 Human Thyroid Carcinomas: Responses to All-Trans-Retinoic Acid and Mutations in the BRAF Gene
- McCoy cell line as a possible model containing CD4+ receptors for the study of HIV-1 replication
- Establishment and characterization of clonal cell lines from the vagina of p53-deficient young mice
User Comments (0)

RSS Feeds