The Immunophilin-Interacting Protein AtFIP37 From Arabidopsis Is Essential for Plant Development and Is Involved in Trichome Endoreduplication1
Posted on: Wednesday, 12 May 2004, 06:00 CDT
The FKBP12 (FK506-binding protein 12 RD) immunophilin interacts with several protein partners in mammals and is a physiological regulator of the cell cycle. In Arabidopsis, only one specific partner of AtFKBP12, namely AtFIP37 (FKBP12 interacting protein 37 kD), has been identified but its function in plant development is not known. We present here the functional analysis of AtFFP37 in Arabidopsis. Knockout mutants of AtFIP37 show an embryo-lethal phenotype that is caused by a strong delay in endosperm development and embryo arrest. AtFIP37 promoter::[beta]-glucuronidase reporter gene constructs show that the gene is expressed during embryogenesis and throughout plant development, in undifferentiating cells such as meristem or embryonic cells as well as highly differentiating cells such as trichomes. A translational fusion with the enhanced yellow fluorescent protein indicates that AtFIP37 is a nuclear protein localized in multiple subnuclear foci that show a speckled distribution pattern. Overexpression of AtFIP37 in transgenic lines induces the formation of large trichome cells with up to six branches. These large trichomes have a DNA content up to 256C, implying that these cells have undergone extra rounds of endoreduplication. Altogether, these data show that AtFIP37 is critical for life in Arabidopsis and implies a role for AtFIP37 in the regulation of the cell cycle as shown for FKBP12 and TOR (target of rapamycin) in mammals.
Immunophilins are a family of enzymes with a peptidyl-prolyl cis- trans isomerase activity (PPiase) involved in the folding of target proteins (Kay, 1996; Schiene-Fischer and Yu, 2001; Hur and Bruice, 2002; Shaw, 2002). Their function has been primarily studied in human immune response as they are receptors for immunosuppressive drugs. Among immunophilins, FK506-binding proteins (FKBPs) are intracellular receptors for the two related drugs, FK506 and rapamycin. FKBPs are found in many organisms, including prokaryotes, animals, and plants (Harrar et al., 2001; Breiman and Camus, 2002).
While FKBPs differ in size, FKBP12 (12 kD) represents the minimal peptide sequence harboring the two main properties of FKBPs, namely the PPiase activity and drug binding. FKBP12 is a ubiquitous and abundant protein localized in the cytosol of mammalian cells (Maki et al., 1990). In mammals, FKBP12 is essential since a knockout mouse dies during embryonic development (Shou et al., 1998), while in yeast (Saccharomyces cerevisiae) loss of FKBP12 function does not affect cell viability (Dolinski et al., 1997). In the absence of drugs, FKBP12 is associated with receptors such as the type II- TGF[beta] (transforming growth factor [beta]) receptor or calcium channels such as the ryanodine receptor or the inositol-(1,4,5)- triphosphate receptor (Ins(1,4,5)P^sub 3^R). When bound to FK506, FKBP12 dissociates from the receptors resulting in a misregulation of receptor activities. For instance, the activity of the TGF[beta] receptor is leaky in the absence of ligand after the release of FKBP12 by FK506 leading to the inactivation by dephosphorylation of Ins(1,4,5)P^sub 3^R (Cameron et al., 1997). Experiments on cells from FKBP12-deficient mice indicate that cells are arrested in Gl because of an enhanced TGF[beta] signaling leading to the overactivation of p21, an inhibitor of the G1/S transition (Aghdasi et al., 2001). FKBP12 appears thus as a regulator of processes such as the cell cycle. When bound to rapamycin, FKBP12 in mammalian cells associates with and inactivates the target of rapamycin (TOR) protein that belongs to the phosphatidylinositol kinase-related kinases family (Raught et al., 2001). TOR promotes cell growth in response to nutrients and plays a role in the phosphorylation of several proteins, such as ribosomal S6 kinase and the translation initiation factor eIF4E-binding protein that are required to achieve high levels of protein synthesis necessary for the G1 to S progression in the cell cycle. Inactivation of TOR by treatment with rapamycin mimics nutrient starvation in yeast, fruitfly (Drosophila melanogaster), and mammalian cells. Loss of dTOR in fruitfly results in a cell-type specific pattern of cell cycle arrest that can be bypassed by overexpression of the cyclin E, an S-phase regulator also involved in endoreduplication (Sauer et al., 1995; Zhang et al., 2000).
In plants, proteins interacting with FKBP12 in the absence or the presence of drug are largely unknown. Only the TOR gene of Arabidopsis has been the focus of a functional analysis in planta, which showed that the disruption of AtTOR leads to embryo lethality (Menand et al., 2002). In a two-hybrid screen for proteins interacting with AtFKBP12, we had previously identified a protein, FKBP12 interacting protein 37kD (AtFIP37), which interacts with AtFKBP12 in a manner that is disrupted by the FK506 drug (Faure et al., 1998). AtFIP37 is a single copy gene in the Arabidopsis genome. In this report, we describe the functional analysis by reverse genetics of the AtFIP37 gene, its pattern of expression together with its intracellular localization, and the consequence of AtFIP37 overexpression in planta. Our data demonstrate that AtFIP37 is critical for embryo and endosperm development and is involved in the endoreplicative cell cycle.
RESULTS
Disruption of AtFIP37 Leads to Premature Arrest of seed Development
To investigate AtFIP37 functions, a search for knockout mutants was performed. Two alleles, atfip37-1 and atfip37-2, were identified using the University of Wisconsin at Madison knockout facility. A third allele, atfip37-3, was identified in the Salk Institute Genomic Analysis Laboratory collection (http://signal.salk. edu; Fig. 1A). Molecular analysis of the atfip37-1 mutant allele showed that it contains two T-DNA insertions inserted head-to-tail in the eighth intron of the AtFIP37 gene. The atfip37-2 and atfip37-3 mutant alleles each contain a single T-DNA insertion located in the promoter region at -49 bp relative to the transcriptional start site as determined by 5'RACE-PCR experiment (data not shown) for atfip37- 2 and at the beginning of the first exon for atfip37-3. We observed that it was not possible to isolate plants homozygous for a T-DNA insertion in the progeny of any atfip37 lines. In the progeny of each of the three heterozygous insertion lines, a 2:1 ratio of segregation for BASTA (a marker carried by the atfip37-1 T-DNA) or kanamycin (a marker carried by the atfip37-2 and atfip37-3 T-DNAs) resistance was observed [for instance, resistant to sensitive ratio of 132:71 for AIFIP37/ atfip37-1 progeny; [chi]^sup 2^ (2/1) = 0.6; P > 0.1] instead of the expected 3:1 ratio. This segregation suggested a default of transmission of the atfip37 alleles to the next generation. Further analysis showed that one-quarter of the seeds from heterozygous immature siliques of the three T-DNA lines had an abnormal white color relative to the wild-type green seeds [green to white seeds ratio of 146:41 in AtFIP37/atfip37-1 siliques; [chi]^sup 2^ (3/1) = 0.33; P > 0.1; Fig. 1B]. The abnormal seeds were randomly distributed along the silique (Fig. 1B) and no segregation distortion was observed, suggesting that the atfip37 mutations had no gametophytic effect. Heterozygous plants displayed no detectable vegetative phenotype.
Figure 1. T-DNA insertions and phenotype of the AtFIP37/atfip37 mutants. A, Representation of the T-DNA insertion sites in atfip37- 1, atfip37-2, and atfip37-3 mutant lines. The left borders of T- DNAs are represented by arrowheads. Black boxes represent exons and white boxes represent 5' and 3' untranslated regions. White triangles beneath the AtFIP37 locus indicate the location of forward (F) and reverse (R) primers used for screening the University of Wisconsin at Madison mutant collection. Numbers are given relative to the transcription start site located 111 bp upstream of the translational start site (Faure et al., 1998). B, A heterozygous silique (10 d after pollination [DAP]) from an AtFIP37-1/atfip37-1 plant.
We further characterized seed development in siliques of heterozygous atfip37-1 plants. The first sign of abnormal seed development was observed in the endosperm. In wild-type seeds, the growth of the endosperm occurs mainly during the syncytial phase, which is characterized by rapid nuclear divisions that are not followed by cell divisions (Fig. 2, A-C; Boisnard-Lorig et al., 2001). This phase is initiated by a series of synchronous nuclear divisions leading to a syncytium with 16 nuclei. After this stage, two or four nuclei situated above the chalaza at the posterior pole stop dividing and initiate cycles of endoreduplication. In parallel, synchronous divisions occur at regular intervals in the rest of the syncytial endosperm leading to developmental stages with approximately 28 nuclei (stage VI), 50 nuclei, and 100 nuclei. After stage VI, nuclear division occurs synchronously in two distinct mitotic domains, the anterior pole that contains the embryo and the peripheral endosperm. At the end of the syncytial phase, an ultimate round of division of peripheral nuclei occurs before the onset of cellularization when the endosperm contains 200 nuclei (Sorensen et al., 2002). In atfip37 see\ds, endosperm growth was already limited during the early syncytial phase (Fig. 2E). A delay in nucleus proliferation was observed as early as the 16 nuclei stage in the wild type since atfip37 endosperm contained only 8 nuclei. This delay corresponding to one mitotic cycle was maintained throughout endosperm development (Fig. 2, F and G compared to B and C, respectively). At the time of endosperm cellularization in the wild type when 200 nuclei are produced during mitotic cycle VIII (embryo at early heart stage), the atfip37 endosperm remained syncytial and contained 90 to 100 nuclei (Fig. 2, J and N). Endosperm cellularization was delayed until the embryo midtorpedo stage in atfip37 (Fig. 2O) while multiple cell layers were present in the wild-type endosperm (Fig. 2K).
Figure 2. Endosperm and embryo development in wild-type and atfip37 mutants. A and E, wild-type and atfip.37-1 seeds, respectively, showing early endosperm with fewer nuclei in mutant endosperm; wild-type endosperm is at stage VI (24-28 nuclei) while mutant endosperm is at stage V (16 nuclei). The nucleolus of each nucleus is clearly visible (black arrow); P, posterior pole with two larger nuclei (white arrows) representing the posterior mitotic domain in wild type that is not differentiated yet in the atfip37-1 endosperm. The embryo in A is not visible in this focal plane. B and F, wild-type and atfip37-1 seeds, respectively, showing the reduced size of the atfip37-seeds relative to the wild type. The embryo in the wild type is at the octant stage while the embryo in atfip37-1 is only at the two cell stage. C and G, wild-type and atfip37-1 seeds, respectively, with proper posterior pole differentiation in both wild-type and atfip37-1 endosperm. The posterior pole differentiates properly. c, cyst; n, nodules. D and H, wild-type and atfip37-1 embryos, respectively, showing a late globular stage wild- type embryo while the atfip37-1 embryo has only reached the early globular stage. I and M, wild-type and atfip37-1 embryos, respectively, showing a late heart stage wild-type embryo and an arrested atfip37-1 embryo. Cell division in atfip37-1 is still active as shown (white arrowhead showing early anaphase). Some cells in the mutant embryo have collapsed (black arrowheads) and lead to alteration of the overall embryo pattern. J and N, wild-type and atfip37-1 seeds, respectively, showing the cellularized wild-type endosperm (embryo at early torpedo stage) while atfip37-1 endosperm remains at syncytial stage VIII. K and O, wild-type and atfip37-1 endosperm, respectively, showing a fully cellularized wild-type endosperm while the mutant endosperm shows only some cellularization. L and P, wild-type and atfip37-1 mature seeds showing the reduced size of the mutant seed. A-C, E-G, J, and N are micrographs of whole mount seeds cleared with Hoyer's medium and observed with Normarski optics. D, H, I, K, M, and O are confocal sections of whole mount seeds. L and P are micrographs of seeds observed with a stereomicroscope. Bars = 20 m (A and E), 40 m (B, C, F, G, J, and N), 15 m (D, H, I, K, M, and O), and 160 m (L and P).
In the wild type, the overall anteroposterior patterning of the endosperm is marked by three mitotic domains along the axis (Boisnard-Lorig et al., 2001) and by the absence of cellularization at the posterior pole where multinucleate masses of cytoplasm differentiate (cyst and nodules; Sorensen et al., 2002). This overall patterning was not affected in atfip37 seeds although the differentiation of mitotic domains along the anteroposterior axis was retarded (Fig. 2, B compared to F) and the development of a cyst and of nodules remained syncytial (Fig. 2N).
Embryo development in atfip37 seeds was also strongly retarded in early embryogenesis (Fig. 2, B-D, F-H); when wild-type embryos had reached the midglobular stage (Fig. 2D), atfip37 embryos had entered only the early-globular stage (Fig. 2H). By the late heart stage in the wild type (Fig. 21), atfip37 embryos had reached only the midglobular stage (Fig. 2M). At that stage, cell division in atfip37- 1 embryos was still active as shown by observation of mitotic figures. The overall pattern of cell division in atfip37 embryos was similar to wild-type embryos with proper definition of the apical- basal axis and of radial symmetry. After this stage atfip37 embryos did not develop further and some embryonic cells collapsed leading to alteration of the overall embryo pattern. The embryo appeared to die during seed maturation where it became hardly visible. Mature atfip37 seeds (Fig. 2P) were smaller than the wild-type counterpart (Fig. 2L).
We therefore concluded that the loss-of-function of AtFIP37 causes a sporophytic recessive seed-lethal phenotype that provides evidence for an essential role of AtFIP37 during embryogenesis and endosperm development. Phenotypic defects are characterized by a general delay in the pace of the cell cycle in the endosperm and in the embryo. Pattern elements properly differentiate in the endosperm and during early embryogenesis. Embryo development arrests at the midglobular stage leading to lethality of the seed.
AtFIP37 Is Expressed Throughout Plant Development
To determine whether AtFIP37 expression was limited to embryo development, the [beta]-glucuronidase (GUS) reporter gene was translationally fused to a portion of the AtFIP37 gene encompassing 1.3 kb of upstream cis sequences up to the beginning of the second exon (Fig. 3A). Transgenic lines were generated and stained to visualize GUS activity. As expected from the atfip37 mutant phenotype, GUS staining was observed during embryogenesis (Fig. 3B). The staining in embryos persisted until the end of embryo development in mature seeds (Fig. 3B). Staining was also present in endosperm and seed integuments (data not shown). GUS staining was not restricted to embryogenesis and was found in all vegetative tissues and organs tested in seedlings and adult plants. Staining was especially pronounced in primary and lateral roots, in leaves including vascular bundles and trichome cells, and in pollen grains of flowers at the postanthesis stage (Fig. 3, C-G). Real time quantitative reverse transcription (RT)-PCR experiments were performed on various organs (Fig. 3H). AtFIP37 transcript was detected in all organs tested including calli and cells. The transcript levels were similar in all organs. Antibodies were raised against the full-length AtFIP37 recombinant protein. Western blots indicated that the protein is also present and in similar amounts in all organs tested (Fig. 31). Altogether these experiments have confirmed the wide expression of AtFIP37 throughout plant development. These data indicate that AIFIP37 is expressed in a constitutive manner in most organs of the plant.
AIFIP37 Is Homologous to Mammalian Proteins Involved in Splicing Processes and Is Localized in Intranuclear Speckles
The initial analysis of AtFIP37 protein sequence indicated a weak identity (20%) with FAP48, a mammalian FKBP12 and FKBP59-associated protein (Chambraud et al., 1996), which has an antiproliferative action and plays a role in T cell activation (Krummrei et al., 2003). Recently, we observed that two animal proteins, HsWTAP and DmFL(2)D, were found to share stronger identities with AtFIP37 (Fig. 4A). The human protein HsWTAP is 34% identical (60% similarity) to AtFIP37 over a 203 residue region. WTAP interacts with the Wilm's tumor factor WT1, an antitumoral protein (Little et al., 2000). WTAP is a nuclear protein localized in splicing speckles and throughout the nucleoplasm and that also colocalizes with splicing factors. The fruitfly protein DmFL(2)D is 34% identical (54% similarity) to AtFIP37 over a 213 residue region. The DmFL(2)D protein is found in nuclear fractions. Although its subnuclear localization has not been determined, DmFL(2)D is clearly involved in the alternative splicing of female-specific pre-mRNAs (Penalva et al., 2000). Secondary structure predictions suggest that three regions in DmFL(2)D form potential coiled coils (Penalva et al., 2000). Interestingly, two of these regions are also found in HsWTAP as well as AtFIP37 (Fig. 4A).
Figure 3. Expression pattern of the AtFIP37 gene and protein. A, Representation of the fusion between AIFIP37 and the uidA (GUS) reporter gene. The HindIII fragment of AtFIP37 locus extending from 1.3 kb upstream of the transcription start site to the beginning of the second exon of AtFIP37 coding sequence was fused in-frame to the GUS coding sequence. The arrow indicates the transcriptional start site. Other symbols are as in Figure 1. B, Embryos (from left to right) at walking-stick, bent-cotyledon, early-mature, and late- mature embryo stages. C, Root apex of a primary root; pr, primary root; ez, elongation zone. D, Lateral root primordium emerging from a primary root; lrp, lateral root primordium; pr, primary root. E, Close-up of a leaf edge showing vasculature and a mature three- branch trichome cell. F, Entire 2-week-old seedling. G, Flower at postanthesis stage. H, Real time quantitative RT-PCR in roots (Ro), rosette leaves (R), stems (S), floral buds (FB), flowers (F), and 9- 10 DAP young siliques (YS), old siliques (OS) about 14 DAP, calli (Ca), and cells (Ce). I, Western-blot analysis using a polyclonal antibody raised against the entire AIFIP37 protein. A polyclonal antibody against the [beta]-tubulin was used as a loading control; abbreviations are like in H. Bars = 500 m in A, B, E, F, and G and 250 m in C and D.
Figure 4. Protein sequence similarities and cellular localization of AtFIP37. A, Alignment of AIFIP37 (accession AAC72922) with the speckle-localized HsWTAP (accession CAC10188) and the putative splicing factor DmFL(2)D (accession NP523732). Positions at which a residue occurs in AtFIP37 and at least in one other sequence are shown by dark boxes. Positions at which a conservative substitution occurs (such as RK, IVL, ED, F\Y, and ST) are shown by shaded boxes. Bars above AIFIP37 sequence indicate potential coiled-coiled structures common to all three sequences as predicted with the coiled-coiled prediction software at http://npsa-pbil.ibcp.fr. In the consensus line, capital letters designate identical residues found in all three sequences while lowercase letters designate identical residues found in two sequences with a conservative substitution in the third sequence. B, Cellular localization of the AtFIP37::eYFP protein in biolistically bombarded leaf cells of Arabidopsis. The top row shows the eYFP fluorescence signal; the bottom row shows the corresponding DAPI fluorescence signal to visualize the nucleus. B1, Nuclear control of an eYFP fused to the lexA::NLS sequence(Kato et al., 2002). B2-4, Localization of the AtFIP37::eYFP protein in speckles. B5, Diffuse nuclear localization of the AtFIP37::eYFP protein. At least 100 nuclei were observed in each experiment. Bars = 10 m. NLS, nuclear localization signal.
The cellular distribution of AtFIP37 was investigated to see whether it is localized in the same compartment as WTAP and FL(2)D. An in-frame translational fusion between the entire AtFIP37 protein and the enhanced yellow fluorescent protein (eYFP) was made. The result of transient expression experiments by biolistic transformation of Arabidopsis leaves are shown in Figure 4B. Similarly to the plants transformed with a nuclear localization control, NLS:: YFP (Fig. 4B, 1), the cells transformed with the AtFIP37::YFP construct showed fluorescence only in the nucleus (Fig. 4B, 2-5), showing that AtFIP37 is a nuclear protein. However, the AtFIP37::YFP protein showed a more complex distribution pattern than the NLS::YFP control. The fluorescence was present in speckles within most nuclei (Fig. 4B, 2-4) and occasionally as a diffuse signal throughout the nucleoplasm within other nuclei (Fig. 4B5). The diffuse to speckle distribution ratio was approximately 1:10. The number of speckles per nucleus was usually 15 to 20 (Fig. 4B, 3 and 4), although occasionally only 5 to 6 could be seen (Fig. 4B, 2). Hence, consistent with its similarities with WTAP and FL(2)D, AtFIP37 is a nuclear protein that shows a speckled distribution pattern, suggesting a possible role in splicing.
Overexpression of AIFIP37 Affects Trichome Development
Because the embryo-lethal phenotype of atfip37 mutants did not allow us to determine the precise function of AtFIP37 in vegetative plant cells, the AIFIP37 cDNA was placed under control of the constitutive 35S promoter and 52 independent transgenic lines were produced. Northern-blot analysis was used to confirm AtFIP37 overexpression (Fig. 5A). These transgenic lines all displayed the same and unique phenotype: numerous, highly branched trichomes on the adaxial leaf epidermis (Fig. 5B). In our conditions, wild-type leaves 1 and 2 had on average 78% three-branch trichomes and 22% four-branch trichomes and no trichomes had more than four branches (Fig. 5, B and C). In 35S::AtFIP37 lines, the total number of trichomes was higher than in the wild type (Fig. 5C). The proportion of four-branch trichomes increased to 42% to 45% while the proportion of three-branch trichomes decreased. More markedly, a new population of five-branch trichomes appeared. In some lines, a six- branch trichome population was even observed (Fig. 5, B and C). On average, 5% to 10% of five and six-branch trichomes were counted on leaves 1 and 2 of 35S::AtFIP37 plants (Fig. 5C).
Figure 5. Overexpression of AtFIP37 and increased trichome branching in transgenic Arabidopsis plants. A, Northern blot performed with 30 g of total RNA extracted from rosettes of wild- type (Col) and two 35S[four dots above]AtFIP37 lines. Endogenous AtFIP37mRNA is barely detectable in wild-type rosettes or other organs (data not shown). Ethidium bromidestained 25S ribosomal RNA is shown as the gel-loading control. B, Illustration of the increase in trichome number and trichome branching in 35S[four dots above]AtFIP37 lines; top row, leaf 2 from wild-type rosette (left), three-branch (center), and four-branch (right) wild-type trichomes; bottom row, leaf 2 of 35S[four dots above]AtFIP37, five-branch (center), and six-branch (right) trichomes. C, Distribution of trichome populations on rosette leaves. Trichomes were counted on the first pair of rosette leaves of 10 plants for each genotype. Numbers on top of histogram bars give the total number of trichomes counted on leaf 1 and 2. Bars =1 mm (leaves) and 150 m (trichomes).
Overexpression of AtFIP37 Increases the Endoreduplication Level in Trichome Nuclei
In a nucleus undergoing endoreduplications, successive S-phase occur without intervening mitosis. Endoreduplication is the first visible cellular event in trichome development prior to cell growth and branching (Hulskamp et al., 1994). Furthermore, in mature trichomes the level of ploidy correlates with the number of branches (Perazza et al., 1999). To determine whether trichomes in 35S[four dots above]AfFIP37 had undergone endoreduplication, we measured the DNA content in these overbranched trichomes. Individual trichomes of wild-type and 35S[four dots above]AtFIP37 plants were isolated and stained with 4',6-diaminophenylindole (Fig. 6A) and computer assisted image analysis was used to quantify their DNA content. Trichomes of wild-type plants had a major peak of DNA content around 32C (Fig. 6B), as expected. The vast majority of these wild-type trichomes (94.4%) had a DNA content below 128C. In contrast, the DNA content of 35S[four dots above]AtFIP37 trichomes showed a much broader distribution with no major peak (Fig. 6B). A large proportion (44.4%) of 35S[four dots above]AtFIP37 trichomes had a DNA content shifted toward values above 128C. Some of these trichomes (9%) had a DNA content above 256C. This indicates that these cells have undergone three extra rounds of endoreduplication relative to wild-type trichomes. To determine whether this increase was restricted to trichome cells, we determined the DNA content of cells from various organs, e.g. leaves, cotyledons, and hypocotyls by flow cytometry; no increase in ploidy was detected in 35S[four dots above]AtFIP37 cell nuclei relative to the wild type (data not shown). Therefore, overexpression of AtFIP37 seems to increase the number of endoreduplication rounds specifically in trichomes.
DISCUSSION
AtFIP37 Is Essential for Endosperm and Embryo Development
The results presented here describe the characterization of the AIFIP37 gene that encodes a protein interacting with AtFKBP12 in yeast and in vitro. Disruption of the AtFIP37 gene leads to endosperm and embryo development arrest indicating an essential role of AtFIP37 during early development of Arabidopsis. Because AtFIP37 is expressed throughout plant development, the function of AtFIP37 is likely to be involved in fundamental aspects of plant cell life, such as cell growth or cell cycle. These fundamental mechanisms would not be required for the early development of the embryo as atfip37 mutant embryos can develop until the globular stage. Interestingly, this embryo-lethal phenotype is similar to the phenotype induced by the disruption of AyTOR (Menand et al., 2002). TOR is a target of the drug rapamycin and regulates the activity of several proteins such as the S6 ribosomal protein kinase that are required to achieve high levels of protein synthesis. In the presence of rapamycin, TOR is inactivated by forming a ternary complex with mammalian FKBP12 and rapamycin. In the Arabidopsis tor mutant, cell division itself is not inhibited and endosperm and embryo developmental arrests could be the consequence of protein synthesis defects since the first cell divisions in the Arabidopsis embryo require little or no increase in overall cell mass (Menand et al., 2002). This hypothesis would also explain why atfip37 mutant embryos can develop only until the globular stage and might suggest that AIFIP37 and AtTOR have overlapping functions in embryogenesis.
Figure 6. Increased DNA content in trichomes of 35S[four dots above]AtFIP37 plants. A, DAPI staining of a wild-type three-branch trichome and a 35S[four dots above]AtFIP37 overbranched trichome. B, Quantification of the DNA content of wild-type and 35S[four dots above]AtFIP37 trichomes. The most highly branched trichomes were collected from wild-type (three- and four-branch trichomes) and 35S[four dots above]AtFIP37 plants (five- and six-branch trichomes) and stained with DAPI. DNA level of three- and four-branch trichomes from 35S[four dots above]AtFIP37plants was similar to wild-type trichomes. The DNA content was quantified under a microscope with a CCD camera using the SAMBA device (Perazza et al., 1999). Bars = 150 m.
The lethality of the AtFIP37 mutant could be a consequence of the alteration of FKBP12 function since both proteins interact. However, we have isolated an AtFKBP12 knockout mutant that does not display an embryo-lethal phenotype (J.-D. Faure, unpublished data). This result indicates that AtFKBP12 is not the unique target of AtFIP37, otherwise both mutants would have a similar phenotype. Because AtFIP37 mutants have the most extreme phenotype, we hypothesize that, besides its interaction with AtFKBP12, AtFIP37 is involved in additional mechanisms or pathways that are essential for plant cell viability.
AtFIP37 does not seem to be involved directly in cytokinesis since cell division was observed in atfip37 embryos. Early steps of wild-type endosperm development involve rapid nuclear divisions without cell division. The fact that endosperm syncytial development is altered in AtFIP37 mutants suggests that AIFIP37 is required for DNA replication and/or nuclear division.
AtFIP37 Modulates Endoreduplication in Trichome Cells
Trichome cells of plants overexpressing AtFIP37 show an increase of DNA content from 32C up to 256C. Endoreduplication requires exit from the m\itotic cycle, transformation of the cell cycle to the endocycle by inhibiting the G2/M transition and promoting G1/S transition, and cell-specific control of the number of endocycles. This process is often cell-specific as guard cells, for instance, exhibit a 2C DNA content while pavement cells exhibit higher DNA content levels (Melaragno et al., 1993). Because overexpression of AIFIP37 affects endoreduplication only in trichomes, we postulate that the decision of AtFIP37 overexpressing cells to endoreduplicate depends on the competence of cells to stop dividing. Trichome cells differentiate very early in leaf primordia (Larkin et al., 1997) and therefore rapidly cease cell division. Although we cannot exclude that other cell types are similarly affected, the function of AtFIP37 in the endoreduplicative cycle would be more pronounced in these cells in 35S[four dots above]AtFIP37 plants as they stop dividing earlier than other cells.
In animals, B-type cyclins are typically involved in mitosis, and of the two G1 cyclins, CYCD and CYCE, CYCE is involved in the initiation of DNA replication, whereas CYCD has been implicated as a sensor of the extracellular growth conditions (Datar et al., 2000). Ectopic expression of one B-type cyclin (CYCB1;2) and of one D-type cyclin (CYCD3;1), specifically in trichomes of Arabidopsis, both induce mitosis, leading to multicellular trichomes (Schnittger et al., 2002a; Schnittger et al., 2002b). Such multicellular trichomes were never observed in 35S[four dots above]AtFIP37 plants. Therefore, it is unlikely that AtFIP37 regulates B- or D-type cyclins in Arabidopsis. Although no CYCE homolog is present in the Arabidopsis genome, we cannot exclude the possibility that AtFIP37 regulates a plant cyclin with functions similar to CYCE. In favor of this hypothesis, the specific cell-type endoreduplication in 35S[four dots above]AtFIP37 trichomes is reminiscent of the specific cell-cycle arrest in dTOR mutant endoreduplicative tissues, a phenotype that can be bypassed by overexpressing CYCE that plays a key role in endoreduplication in fruitfly (Richardson et al., 1995).
An increase in ploidy level often correlates with an increase in nuclear volume and cell size in both animals and plants (Melaragno et al., 1993; Cebolla et al., 1999; Edgar and Orr-Weaver, 2001). This is also true for trichomes of 35S[four dots above]AtFIP37 plants as trichome nuclei display a larger volume than wild-type nuclei and trichome cells are enlarged with extra branches. This observation indicates that AtFIP37 does not uncouple the two cellular processes unlike KRP2 for instance, a cyclin-dependent kinase inhibitor that when overexpressed in Arabidopsis affects endoreduplication but not cell enlargement (De Veylder et al., 2001). From this point of view, overexpression of AtFIP37 mimics the loss-of-function phenotype of trichome-specific genes such as TRIPTYCHON (Schellmann et al., 2002), KAKTUS (Perazza et al., 1999; Dowries et al., 2003; El Refy et al., 2003), POLYCHOME, and RASTAFARi (Perazza et al., 1999).
AtFIP37 Protein Might Play a Role in Splicing
The localization of the AtFIP37 protein in speckles within the nucleus and its similarity to HsWTAP and DmFL(2)D strongly suggest that AtFIP37 has a role in pre-mRNA splicing. Interestingly, AtSRp30, an SF2/ASF-like protein that functions as a splicing modulator, also induces the formation of overbranched trichomes when overexpressed in Arabidopsis (Lopato et al., 1999). AtSRp30 is expressed ubiquitously including trichome basal cells. Its overexpression also results in changes in alternative splicing of several splicing genes, including AtSRp30 itself.
A possible role for AtFIP37 in endoreduplication is the regulation by alternative splicing of genes that play a role in the cell cycle, especially the endoreduplicative cycle. This assumption cannot be tested in vitro, as no plant splicing extracts are available (Lopato et al., 1999). Our attempts to identify abnormal splicing of several genes in 35S[four dots above]AtFIP37 plants involved in the cell cycle, endoreduplication, or trichome development have not been successful so far. It is possible that a modification in splicing of one of these genes specifically in trichome cells could not be detected in our conditions or that AtFIP37 regulates the splicing of other genes yet to be identified. Alternatively, we cannot exclude that AtFIP37 does not regulate cell- cycle events and that endoreduplication in trichome cells is an indirect effect of AtFIP37 activity on splicing in overexpressing lines.
In conclusion, this study shows that AtFIP37 is essential for viability in Arabidopsis and appears to be involved in specific cell- cycle regulation. Our findings open up new fields for investigating the molecular mechanisms of AtFIP37 and immunophilin action in plants. The strong phenotype of AtFIP37 mutants together with 1) the general expression pattern of the gene, 2) subcellular localization of AtFIP37 in nuclear speckles, and 3) the similar AtSRp30 and AtFIP37 overexpression phenotype suggest a general role of AtFIP37 in plant splicing events. Future functional studies such as the identification of AtFIP37 protein partners in the plant spliceosome will help us understand the crucial role of AtFIP37 in plant cells.
MATERIALS AND METHODS
Plant Material and Growth Conditions
Transgenic lines 35S[four dots above]AtFIP37 and P^sub AtFIP37^[four dots above]GUS are in the Columbia (Col) ecotype. Five independent transgenic lines were studied that all showed the same GUS expression pattern. T-DNA insertion mutants atfip37-1 and -2 are in the Wassilewskija ecotype while atfip37-3 is in the Col ecotype. Plants were grown at 25C under a 16-h light/8-h dark regime. Wild- type plants were transformed by the floral dip method (Clough and Bent, 1998) using Agrobacterium tumefaciens C58 pGV2260 strain (Deblaere et al., 1985). Transgenic plants were selected in vitro on Murashige and Skoog medium with one-fifth of the normal concentration of macroelements (Koncz et al., 1990) containing phosphinotricin herbicide (1.2 g mL^sup -1^) for atfip37-1 line or kanamycin (50 g mL^sup -1^) for other transgenic lines.
Tissue Preparation and Microscopy
GUS staining of plant organs was performed as previously described (Gallagher, 1992) with an overnight incubation at 37C. Tissues were then fixed and cleared in an ethanol to acetic acid solution (3:1, v/v) and washed in ethanol 70% (v/v). After progressive rehydration, tissues were mounted in 50% (v/v) glycerol and observed with an Eclipse E-600 microscope (Nikon, Tokyo). Mutant phenotype was observed with Normarski optics in whole mount seeds cleared with modified Hoyer's medium (Mayer et al., 1991). Observations were done with an Optiphot 2 microscope (Nikon) using 20 differential interference contrast and 40 differential interference contrast objectives. Images were acquired with a small CCD camera and digitized using the software Axiovision (Zeiss, Jena, Germany). Observation of embryo phenotype and of endosperm cellularization were performed with a Laser Scanning Confocal Microscope Zeiss LSM 510 equipped with the software on whole mount seeds stained as reported previously (Sorensen et al., 2002). We used a 1.4 numerical aperture 63 Plan Apo objective (Zeiss). Single optical sections have a 1.1- to 1.3-m thickness.
Digital images of whole dried seeds were obtained with an MZ FL III stereomicroscope (Leica, Wetzlar, Germany) with a Plan Apo 1 objective and equipped with an annular illumination system (Leica) and a CCD camera driven by the Leica FW 4000 software. All images were processed with Photoshop software 5.5 (Adobe Systems, Mountain View, CA).
For DNA measurements, trichomes were isolated from the first pair of rosette leaves of 15-d-old soil grown wild-type or 35S[four dots above]AtFIP37 plants. For each line, trichome cells from about 30 leaves were used. Trichomes were then fixed, stained with 4',6- diamidinophenylindole (DAPI), and the DNA content was quantified by the SAMBA image analysis system as previously described (Perazza et al., 1999).
Constructs
The 35S[four dots above]AtFIP37 construct was made by cloning the full-length blunt-ended 1.1-kb cDNA of AtFIP37 downstream of the constitutive CaMV-35S promoter into the SmaI site of the pBEV1 binary expression vector derived from pBI121 (CLONTECH Laboratories, Palo Alto, CA) from which the GUS reporter gene was deleted.
For the P^sub AtFIP37^[four dots above]GUS construct, the approximately 6-kb BglII fragment encompassing the AtFIP37 locus on the bacterial artificial chromosome F24B22 was first isolated and cloned into the BamHI site pBluescript KSII vector (Stratagene, La Jolla, CA). The HindIII promoter fragment was then subcloned into the HindIII site of pBluescript KSII and finally cloned as an approximately 1.5-kb SalI-EcoRV fragment between SalI and SmaI sites of pBI101. The inframe junction between AtFIP37 and GUS genes was verified by sequencing.
For the AtFIP37[four dots above]eYFP fusion construct, the entire 1.1-kb AtFIP37 coding sequence was isolated as follows. One mg of total RNA from wild-type rosettes was reverse-transcribed with poly(dT) primer and the AtFIP37 sequence was amplified by PCR with specific forward and reverse oligonudeotides containing 5'- restriction sites for the subsequent cloning steps (forward 5'- TCTAGAATGGAGTTTTCATCACAAGACGA and reverse 5'- ACTAGTTTCTCCACCAGCAATTTCTTCTT). After cloning of the amplicon into the pCRII-TOPO vector (Invitrogen, Carlsbad, CA) and sequencing, the XbaI-SpeI fragment was cloned into the Xbal site of vector peYFP-SK upstream of the eYFP gene (Kato et al., 2002). The in-frame fusion was verified by sequencing and the entire AtFIP37[four dots above]YFP fusion gene was then cloned as an XbaI-SalI fragment into the binary vector pEL103 digested by XbaI and SacI using a SalI- SacI adaptor, downstream of the 355 promote\r (Kato et al., 2002) giving rise to vector pEL-AtFIP37[four dots above]eYFP. Expression analysis was then performed by transient biolistic transformation of the abaxial (lower) surface of Arabidopsis leaves using the PDS- 1000/He Biolistic Particle Delivery System (BioRad, Hercules, CA). Transformations were performed with 5 g of pEL-AtFIP37[four dots above]eYFP or pEL103 vector fixed on 3 ng of 1-m gold beads. Fluorescence was observed 2 d later under microscope equipped with a UV light and a YFP filter (Nikon; excitation filter, 510-520 nm; dichroic mirror, 530 ran; Barrier filter, 540-560 nm).
Knockout Screening and Analysis
For atfip37-1 and -2, mutant screening was performed according to the Arabidopsis knockout facility of the University of Wisconsin Biotechnology Center (http://www.biotech.wisc.edu). For PCR on DNA pools, the JL-202 primer (5'-CATTTTATAATAACGCTGCGGACATCTAC-3') corresponding to the T-DNA left-border was combined with either 5' or 3' AtFIP37 specific primers (5'-TCCTATTCTCCACCAGCAATTTCTTCTT-3' or 5'-TCCTATTCTCCACCAGCAATTTCTTCTTT-3', respectively). Positive amplicons were assessed by Southern blot using a full-length AtFIP37 cDNA as a radiolabeled probe. Individual plants in positive pools were screened by PCR with the same oligonudeotides. Transgene segregation in the progeny of positive individual plants was analyzed by selection on phosphinotricin (atfip37-1 mutant) or kanamycin (atfip37-2 mutant). Both alleles were backcrossed into the wild-type ecotype twice and once, respectively, to eliminate potential second-site mutations.
For the atfip37-3 allele, insertion mutant information (accession number SALK_029377) was obtained from the SIGnAL website at http:// signal.salk.edu.
Allelism test indicated that the atfip37-3 was allelic to atfip37- 1 and atfip37-2 as F1 seeds showed a 3:1 wild-type to aborted seed ratio.
Real Time RT-PCR and Western Blots
Reverse transcription and PCR reactions were performed according to the manufacturer of the ABI 5700-SDS (Applied Biosystems, Foster City, CA) using SyBRgreen as the fluorescent DNA marker. Relative transcript levels of AtFIP37 were calculated with the [Delta][Delta]Ct method using EF-[alpha] as the reference gene. For each gene, one primer was designed to overlap an intron-exon junction to avoid amplification of contaminant genomic DNA. Primers were designed with the PrimerExpress 1.5 software (Applied Biosystems): AtFIP37 forward 5'-GTCTCAAAACGCGGAACTTAGAA; reverse 5'- TCCATGTGTTTGTACAGTCCTTCAA and EF-1[alpha] forward 5'- TGCTTTCACCCTTGGTGTCA; reverse 5'-TGGTGGCATCCATCTTGTTACA.
For western-blot experiments, the anti-AtFIP37 rabbit polyclonal antibody was raised against the full-length AtFIP37 recombinant protein produced in Escherichia coli (expression vector pQE-30, Qiagen, Valencia, CA). Total proteins from plants were extracted as described (Hurkman and Tanaka, 1988) and 40 to 80 g by sample were migrated on a 12.5% SDS-PAGE. After semidry transfer in Bjerrum and Shafer-Nielsen buffer (48 mM Tris, 39 mM glycine, 20% (v/v) isopropanol, pH 9.2) on nitrocellulose membrane (Hybond-P, Amersham, Buckinghamshire, UK), filters were saturated 2 h in TBS plus Tween 20 (0.1%, v/v) and milk powder (5%, w/v), incubated 3 h in the same buffer containing anti-AtFIP37 (1/1,000), washed three times in TBS plus Tween 20 (0.1%) and incubated l h in 1/3000 secondary antibody solution (goat anti-rabbit IgG horseradish peroxydase conjugated, BioRad). Proteins were then revealed using ECL (Amersham) on Biomax MS (Eastman-Kodak, Rochester, NY) films. [beta]-Tubulin was detected with a 1/250 monoclonal antibody solution (Sigma-Aldrich, St. Louis) and a 1/3000 secondary goat anti-mouse IgG horseradish peroxydase conjugated (BioRad) solution.
Upon request, all novel materials described in this publication will be made available in a timely manner for noncommercial research purposes, subject to the requisite permission from any third-party owners of all parts of the material. Obtaining any permissions will be the responsibility of the requestor.
Sequence data from this article have been deposited with the EMBL/ GenBank data libraries under accession numbers SALK_129377, AAC72922, CAC10188, and NP523732.
ACKNOWLEDGMENTS
We are grateful to Dr. Dominique Pontier (Universite de Perpignan, France) and Dr. Naohiro Kato and Dr. Eric Lam (Rutgers, The State University of New Jersey, New Brunswick, NJ) for the gift of pYFP[four dots above]lexA[four dots above]NLS and pEL103 vectors. We thank Dr. Maryline Vantar (Centre d'Etudes Atomiques, Grenoble, France) for the gift of the anti-[beta]-tubulin antibody. We thank Dr. Jean-Marc Bonneville (Laboratoire Plastes et Differenciation Cellulaire, Grenoble, France) for useful discussions and critical reading of the manuscript. We also thank Dr. Spencer Brown (Institut des Sciences du Vegetal, Gif-sur-Yvette, France) for flow cytometry experiments. We thank Nicole Potier, Jean-Pierre Alcaraz, and Eliane Charpentier (Laboratoire Plastes et Differenciation Cellulaire) for their technical assistance. We thank the Salk Institute Genomic Analysis Laboratory for providing the sequence-indexed Arabidopsis T- DNA insertion mutants.
Received June 4, 2003; returned for revision June 24, 2003; accepted July 4, 2003.
1 This work was supported by a doctoral fellowship in the EMERGENCE program of the Region Rhone-Alpes (to L.V.) and by the Institut National de la Recherche Agronomique and the European Molecular Biology Organization Young Investigators Programme fellowship (to F.B.). Funding for the SIGnAL indexed insertion mutant collection was provided by the National Science Foundation.
LITERATURE CITED
Aghdasi B, Ye K, Resnick A, Huang A, Ha HC, Guo X, Dawson TM, Dawson VL, Snyder SH (2001) FKBP12, the 12-kDa FK506-binding protein, is a physiologic regulator of the cell cycle. Proc Natl Acad Sci USA 98: 2425-2430
Boisnard-Lorig C, Colon-Cannona A, Bauch M, Hodge S, Doerner P, Bancharel E, Dumas C, Haseloff J, Berger F (2001) Dynamic analyses of the expression of the HISTONE[four dots above]YFP fusion protein in arabidopsis show that syncytial endosperm is divided in mitotic domains. Plant Cell 13: 495-509
Breiman A, Camus I (2002) The involvement of mammalian and plant FK506-binding proteins (FKBPs) in development. Transgenic Res 11: 321-335
Cameron AM, Nucifora FC Jr, Fung ET, Livingston DJ, Aldape RA, Ross CA, Snyder SH (1997) FKBP12 binds the inositol 1,4,5- trisphosphate receptor at leucine-proline (1400-1401) and anchors calcineurin to this FK506-like domain. J Biol Chem 272: 27582-27588
Cebolla A, Vinardell JM, Kiss E, Olah B, Roudier F, Kondorosi A, Kondorosi E (1999) The mitotic inhibitor ccs52 is required for endoreduplication and ploidy-dependent cell enlargement in plants. EMBO J 18: 4476-4484
Chambraud B, Radanyi C, Camonis JH, Shazand K, Rajkowski K, Baulieu EE (1996) FAP48, a new protein that forms specific complexes with both immunophilins FKBP59 and FKBP12. Prevention by the immunosuppressant drugs FK506 and rapamycin. J Biol Chem 271: 32923- 32929
Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735-743
Datar SA, Jacobs HW, de la Cruz AF, Lehner CF, Edgar BA (2000) The Drosophila cyclin D-Cdk4 complex promotes cellular growth. EMBO J 19: 4543-4554
De Veylder L, Beeckman T, Beemster GT, Krols L, Terras F, Landrieu I, van der Schueren E, Maes S, Naudts M, Inze D (2001) Functional analysis of cyclin-dependent kinase inhibitors of Arabidopsis. Plant Cell 13: 1653-1668
Deblaere R, Bytebier B, De Greve H, Deboeck F, Schell J, Van Montagu M, Leemans J (1985) Efficient octopine Ti plasmid-derived vectors for Agrobacterium-mediated gene transfer to plants. Nucleic Acids Res 13:4777-4788
Dolinski K, Muir S, Cardenas M, Heitman J (1997) All cyclophilins and FK506 binding proteins are, individually and collectively, dispensable for viability in Saccharomyces cerevisiae. Proc Natl Acad Sci USA 94: 13093-13098
Downes BP, Stupar R, Gengerich DJ, Viestra RD (2003) The HECT ubiquitin-protein ligase (UPL) family in Arabidopsis: UPL3 has a specific role in trichome development. Plant J 35: 729-742
Edgar BA, Orr-Weaver TL (2001) Endoreplication cell cycles: more for less. Cell 105: 297-306
El Refy A, Perazza D, Zekraoui L, Valay JG, Bechtold N, Brown S, Hulskamp M, Herzog M, Bonneville JM (2003) The Arabidopsis KAKTUS gene encodes a HECT protein and controls the number of endoreduplication cycles. Mol Gen Genomics 270: 403-414
Faure JD, Gingerich D, Howell SH (1998) An Arabidopsis immunophilin, AtFKBP12, binds to AtFIP37 (FKBP interacting protein) in an interaction that is disrupted by FK506. Plant J 15: 783-789
Gallagher SR (1992) Quantitation of GUS activity by fluorometry. In Gallagher SR, ed., GUS Protocols: Using the GUS Gene as a Reporter of Gene Expression. Academic Press, San Diego, pp 47-59
Harrar Y, Bellini C, Faure JD (2001) FKBPs: at the crossroads of folding and transduction. Trends Plant Sci 6: 426-431
Hulskamp M, Misera S, Jurgens G (1994) Genetic dissection of trichome cell development in Arabidopsis. Cell 76: 555-566
Hur S, Bruice TC (2002) The mechanism of cis-trans isomerization of prolyl peptides by cyclophilin. J Am Chem Soc 124: 7303-7313
Hurkman WJ, Tanaka CK (1988) Polypeptide changes induced by salt stress, water deficit, and osmotic stress in barley roots: a comparison using two-dimensional gel electrophoresis. Electrophoresis 9: 781-787
Kato N, Pontier D, Lam E (2002) Spectral profiling for the simultaneous observation of four distinct fluorescent proteins and detection of protein-protein interaction via fluorescence resonance energy transfer in tobacco leaf nuclei. Plant Physiol 129: 931-942
Kay JE (1996) Structure-function relationships in the FK506- binding protein (FKBP) family of peptidylprolyl cis-trans isomerases. Biochem J 314: 361-385
Koncz C, Mayerhofer R, Koncz-Kalman Z, Nawrath C, Reis\s B, Redei GP, Schell J (1990) Isolation of a gene encoding a novel chloroplast protein by T-DNA tagging in Arabidopsis thaliana. EMBO J 9: 1337- 1346
Krummrei U, Baulieu EE, Chambraud B (2003) The FKBP-associated protein FAP48 is an antiproliferative molecule and a player in T cell activation that increases IL2 synthesis. Proc Natl Acad Sci USA 100: 2444-2449
Larkin JC, Marks D, Nadeau J, Sacks F (1997) Epidermal cell fate and patterning in leaves. Plant Cell 9: 1109-1120
Little NA, Hastie ND, Davies RC (2000) Identification of WTAP, a novel Wilms' tumour 1-associating protein. Hum Mol Genet 9: 2231- 2239
Lopato S, Kalyna M, Dorner S, Kobayashi R, Krainer AR, Barta A (1999) atSRp30, one of two SF2/ASF-like proteins from Arabidopsis thaliana, regulates splicing of specific plant genes. Genes Dev 13: 987-1001
Maki N, Sekiguchi F, Nishimaki J, Miwa K, Hayano T, Takahashi N, Suzuki M (1990) Complementary DNA encoding the human T-cell FK506- binding protein, a peptidylprolyl cis-trans isomerase distinct from cyclophilin. Proc Natl Acad Sci USA 87: 5440-5443
Mayer U, Ruiz RAT, Berleth T, Misera S, Jurgens G (1991) Mutations affecting body organization in the Arabidopsis embryo. Nature 353: 402-407
Melaragno JE, Mehrotra B, Coleman AW (1993) Relationship between endopolyploidy and cell size in epidermal tissue of Arabidopsis. Plant Cell 5: 1661-1668
Menand B, Desnos T, Nussaume L, Berger F, Bouchez D, Meyer C, Robaglia C (2002) Expression and disruption of the Arabidopsis TOR (target of rapamycin) gene. Proc Natl Acad Sci USA 99: 6422-6427
Penalva LO, Ruiz MF, Ortega A, Granadino B, Vicente L, Segarra C, Valcarcel J, Sanchez L (2000) The Drosophila fl(2)d gene, required for female-specific splicing of Sxl and tra pre-mRNAs, encodes a novel nuclear protein with a HQ-rich domain. Genetics 155: 129-139
Perazza D, Herzog M, Hulskamp M, Brown S, Dorne A-M, Bonneville J- M (1999) Negative control of trichome cell size in Arabidopsis thaliana involves at least five genes. Genetics 152: 461-471
Raught B, Gingras AC, Sonenberg N (2001) The target of rapamycin (TOR) proteins. Proc Natl Acad Sci USA 98: 7037-7044
Richardson H, O'Keefe LV, Marty T, Saint R (1995) Ectopic cyclin E expression induces premature entry into S phase and disrupts pattern formation in the Drosophila eye imaginai disc. Development 121: 3371-3379
Sauer K, Knoblich JA, Richardson H, Lehner CF (1995) Distinct modes of cyclin E/cdc 2c kinase regulation and S-phase control in mitotic and endoreduplkation cycles of Drosophila embryogenesis. Genes Dev 9: 1327-1339
Schellmann S, Schnittger A, Kirik V, Wada T, Okada K, Beermann A, Thumfahrt J, Jurgens G, Hulskamp M (2002) TRIPTYCHON and CAPRICE mediate lateral inhibition during trichome and root hair patterning in Arabidopsis. EMBO J 21: 5036-5046
Schiene-Fischer C, Yu C (2001) Receptor accessory folding helper enzymes: the functional role of peptidyl prolyl cis/trans isomerases. FEBS Lett 495: 1-6
Schnittger A, Schobinger U, Bouyer D, Weinl C, Stierhof Y-D, Hulskamp M (2002a) Ectopic D-type cyclin expression induces not only DNA replication but also cell division in Arabidopsis trichomes. Proc Natl Acad Sci USA 99: 6410-6415
Schnittger A, Schobinget U, Stierhof YD, Hulskamp M (2002b) Ectopic B-type cyclin expression induces mitotic cycles in endoreduplicating Arabidopsis trichomes. Curr Biol 12: 415-420
Shaw PE (2002) Peptidyl-prolyl isomerases: a new twist to transcription. EMBO Rep 3: 521-526
Shou W, Aghdasi B, Armstrong DL, Guo Q, Bao S, Charng MJ, Mathews LM, Schneider MD, Hamilton SL, Matzuk MM (1998) Cardiac defects and altered ryanodine receptor function in mice lacking FKBP12. Nature 391: 489-492
Sorensen MB, Mayer U, Lukowitz W, Robert H, Chambrier P, Jurgens G, Somerville C, Lepiniec L, Berger F (2002) Cellularisation in the endosperm of Arabidopsis thaliana is coupled to mitosis and shares multiple components with cytokinesis. Development 129: 5567-5576
Zhang H, Stallock JP, Ng JC, Reinhard C, Neufeld TP (2000) Regulation of cellular growth by the Drosophila target of rapamycin dTOR. Genes Dev 14: 2712-2724
Laurent Vespa, Gilles Vachon, Frederic Berger, Daniel Perazza, Jean-Denis Faure, and Michel Herzog*
Laboratoire Plastes et Differenciation Cellulaire, Centre National de la Recherche Scientifique, Unite Mixte de Recherche 5575, Universite Joseph Fourier, F-38041 Grenoble cedex 9, France (L.V., G.V., D.P., M.H.); Laboratoire Reproduction et Developpement des Plantes, Unite Mixte de Recherche 5667, Institut National de la Recherche Agronomique, Centre National de la Recherche Scientifique, Universite Lyon I, Ecole Normal Superieure de Lyon, F-69364 Lyon cedex 07, France (F.B.); and Laboratoire de Biologie Cellulaire, Institut National de la Recherche Agronomique, F-78026 Versailles cedex, France (J-D.F.)
* Corresponding author; e-mail michel.herzog@ujf-grenoble.fr; fax 33-476-51-43-36.
Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.103.028050.
Copyright American Society of Plant Physiologists Apr 2004
Related Articles
- Scientists Visualize Assembly Line Gears In Ribosomes, Cell's Protein Factory
- Stem Cell Protein Shows A New Cancer Target
- Mutant Host Cell Protein Sequesters Critical HIV-1 Element
- Cell Proteins Prevent Expanding Stomach
- Study Finds Cell Protein That Stops HIV
- Immune Cell Protein May Fight Asthma
- Amorcyte Cardiac Cell Therapy Trial Completes Second of Four Phases
- Newest amfAR Grants Announced: Can Frogs Help Humans Fight HIV? Scientist Pursues Microbicides From Amphibian Cell Proteins
- 2 Israelis, American Win Nobel -- Cell-Protein Work Nets Chemistry Prize
- Induced sputum analysis for T helper type 2 cell regulation: Closing the loop
User Comments (0)

RSS Feeds